Taphrina tosquinetii

(Westend.) Magnus · species

image placeholder — illustration coming later

Fungi/Ascomycota/Taphrinomycetes/Taphrinales/Taphrinaceae/Taphrina

At a glance

Occurrence records1 871

Data sources9

Biological traits0

DNA specimens1

eDNA detections19

Sources9 archives

Databases and archives Taphrina tosquinetii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 871 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 871 records

Environmental DNA6 datasets · 3 countries19 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Taphrina tosquinetii is a fungal plant pathogen that causes large blisters on both surfaces of the leaves of alder.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taphrina tosquinetii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections19

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ013119.1 ↗583 bpSlovakia

ACGT

AAGGATCATTAATGAAGTCTGGGCTTCGGCCCTCTCTCTTCTACACACTTGTGAACTTACACTGTTGCTTTGGCAGGTATCTCGAAGGAC …

Taphrina tosquinetii voucher HA:1335 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type1 871 records

Wild obs. + sensor1 685

Museum / vouchered183

Other3

Range

Area of Occupancy AOO5 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 547≤1 km 245≤10 km 831>10 km 4

1 627 georeferenced · 58 without coordinates

Open the mapobservation + sensor1 685

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 5≤1 km 68≤10 km 45>10 km 26

144 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	52
Bernard Price Institute for Palaeontological Researchlocation not on record	27
Uppsala, SE	25
Helsinki, FI	24
LDlocation not on record	15
Tartu, EE	4
Bronx, US	4
WU-MYClocation not on record	3
Catholic University of Pekinglocation not on record	2
Kew, GB	2
Görlitz, DE	2
Champaign, US	2
Copenhagen, DK	2
Lincoln, US	1
Slovenian Forestry Institutelocation not on record	1
Auckland, NZ	1
PHlocation not on record	1
Stockholm, SE	1
Zürich, CH	1
Baton Rouge, US	1
TROMlocation not on record	1
SLU Artdatabankenlocation not on record	1
Brown Universitylocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1

24 institutions · 175 of 183 vouchered records shown · 8 without an institution code

09Environmental DNA19 detections

Where the DNA of Taphrina tosquinetii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys6

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 14.0–16.7

Seasonal swing summer↔winter21.9 °C

Max temp (day)20.8 °C 18.4–20.8

Min temp (night)13.0 °C 9.30–13.0

Precipitation82.3 mm/mo 62.9–82.3

Air humidity61.5 % 61.5–61.7

Moisture balance-18.7 mm/mo -21.7–-18.7

Vapour deficit732 Pa 641–732

Wind speed3.60 m/s 3.60–3.80

Cloud cover42.5 % 41.8–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Taphrina tosquinetii

At a glance

Sources9 archives

At a glance

Record type1 871 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 871 records