Taphrina polystichi — The Life Data

Fungi/Ascomycota/Taphrinomycetes/Taphrinales/Taphrinaceae/Taphrina

At a glance

Occurrence records305

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Taphrina polystichi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility305 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF305 records

DNA & barcodingNCBIsequences

01Narrative

Taphrina polystichi is an ascomycete fungus that parasitizes Christmas fern (Polystichum acrostichoides) in eastern North America. It was described by A. J. Mix in 1938.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taphrina polystichi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF492105.1 ↗580 bp

ACGT

AAGGATCATTAATGAAGTCTGGGCTTCGGCCCTCTCTCTTCTACACACTTGTGAACTTACACCGTTGCTTTGGCAGGTCTCCGGACGGGC …

Taphrina polystichi strain CBS 379.39 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type305 records

Wild obs. + sensor210

Museum / vouchered94

Other1

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 98≤1 km 26≤10 km 9>10 km 29

162 georeferenced · 48 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 2≤1 km 11≤10 km 37>10 km 7

57 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	36
Bronx, US	30
Lincoln, US	9
Madison, US	5
Catholic University of Pekinglocation not on record	4
Pullman, US	3
Cincinnati, US	2
TENN-Flocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
Ann Arbor, US	1

10 institutions · 94 of 94 vouchered records shown