Taphrina padi

(Jacz.) Mix · species

image placeholder — illustration coming later

Fungi/Ascomycota/Taphrinomycetes/Taphrinales/Taphrinaceae/Taphrina

At a glance

Occurrence records2 009

Data sources9

Biological traits0

DNA specimens2

eDNA detections81

Sources9 archives

Databases and archives Taphrina padi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 009 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 009 records

Environmental DNA9 datasets · 14 countries81 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Taphrina padi is a fungal plant pathogen that induces the form of pocket plum gall that occurs on bird cherry (Prunus padus). The gall is a chemically induced distortion of the fruits, which are swollen, hollow, curved and greatly elongated, without a seed or stone, but retaining the style.Stubbs, Page 43 The twigs on infected plants may also be deformed with small strap-shaped leaves.Redfern, Page 249

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taphrina padi has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections81

Countries14

The DNA barcodea real sequence read deposited for this species

ITSKU134843.1 ↗567 bp

ACGT

AACCCTCTCTCTTCTACACACTTGTGAACTTACACTGTTGCTTTGGCAGGTCTCCTGAAGGATGTAAATCCCGACGGCCAGGTCGAAAGA …

Taphrina padi strain TPa001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1

fungal barcode

08Occurrence & distribution

Record type2 009 records

Wild obs. + sensor1 779

Museum / vouchered230

Range

Area of Occupancy AOO5 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 761≤1 km 182≤10 km 684>10 km 7

1 634 georeferenced · 145 without coordinates

Open the mapobservation + sensor1 779

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 8≤1 km 21≤10 km 25>10 km 28

82 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	45
Uppsala, SE	36
Olocation not on record	11
Stockholm, SE	8
LDlocation not on record	7
	6
Helsinki, FI	6
Bernard Price Institute for Palaeontological Researchlocation not on record	6
WU-MYClocation not on record	5
Karlsruhe, DE	5
SLU Artdatabankenlocation not on record	4
Oskarshamn, SE	3
Trondheim, NO	3
Joensuu, FI	2
TROMlocation not on record	2
Pullman, US	2
Tartu, EE	2
Philadelphia, US	2
Berlin, DE	2
Kew, GB	1
Canberra, AU	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
IFR-DNFlocation not on record	1
Gijón, ES	1
Mlocation not on record	1
ARMS-MBONlocation not on record	1

26 institutions · 164 of 230 vouchered records shown · 66 without an institution code

09Environmental DNA81 detections

Where the DNA of Taphrina padi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys9

Countries14

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map14 countries0

Industrial port; industrial; 9.2 - Subtidal …Aspen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 3.10–16.8

Seasonal swing summer↔winter22.4 °C

Max temp (day)17.2 °C 5.00–20.7

Min temp (night)9.00 °C -0.4–12.8

Precipitation76.6 mm/mo 41.6–157

Air humidity59.9 % 56.7–65.2

Moisture balance3.70 mm/mo -51.8–59.7

Vapour deficit608 Pa 258–773

Wind speed3.00 m/s 2.30–4.30

Cloud cover42.0 % 37.5–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Taphrina padi

At a glance

Sources9 archives

At a glance

Record type2 009 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 009 records