Taphrina betulina

Rostr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Taphrinomycetes/Taphrinales/Taphrinaceae/Taphrina

At a glance

Occurrence records7 840

Data sources10

Biological traits0

DNA specimens2

eDNA detections53

Sources10 archives

Databases and archives Taphrina betulina's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 840 records

Environmental DNA6 datasets · 9 countries53 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈12 Mbp

01Narrative

Taphrina betulina is a fungal plant pathogen that causes the gall, witches broom, which is a chemical infection of birch buds or the developing shoots, leading to a proliferation of growth. It was first described by Emil Rostrup in 1883 and is found in Europe, New Zealand and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taphrina betulina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections53

Countries9

The DNA barcodea real sequence read deposited for this species

ITSAF492079.1 ↗575 bp

ACGT

ATTAATGAAGTCTGGGCTTCGGCCCTCTCTCTTCTACACACTTGTGAATCTACACTGTTGCTTTGGCAGGTAGCCGGACGGACGTGAGTC …

Taphrina betulina strain CBS 417.54 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Taphrina betulina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈12 483 756 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Taphrina betulina0.01 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type7 840 records

Wild obs. + sensor7 540

Museum / vouchered296

Other4

Range

Area of Occupancy AOO18 152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 3 748≤1 km 1 187≤10 km 2 349>10 km 11

7 295 georeferenced · 245 without coordinates

Open the mapobservation + sensor7 540

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 7≤1 km 110≤10 km 55>10 km 84

256 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	88
Uppsala, SE	79
Helsinki, FI	35
TROMlocation not on record	28
Bernard Price Institute for Palaeontological Researchlocation not on record	11
LDlocation not on record	5
SLU Artdatabankenlocation not on record	4
Auckland, NZ	3
Tartu, EE	3
Karlsruhe, DE	3
Catholic University of Pekinglocation not on record	3
Lincoln, US	2
Chicago, US	2
Champaign, US	2
Zürich, CH	2
Norwegian Institute of Bioeconomy Researchlocation not on record	2
	2
CA	1
Pullman, US	1
Umeå Universitylocation not on record	1
Madison, US	1
Trondheim, NO	1
Görlitz, DE	1
IFR-DNFlocation not on record	1
Göteborg, SE	1
Oskarshamn, SE	1
Copenhagen, DK	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
Bronx, US	1

29 institutions · 286 of 296 vouchered records shown · 10 without an institution code

09Environmental DNA53 detections

Where the DNA of Taphrina betulina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys6

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map9 countries0

Coniferous forestBirch sphagnum forestAspen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 9.10–15.2

Seasonal swing summer↔winter20.3 °C

Max temp (day)14.1 °C 11.4–18.7

Min temp (night)8.10 °C 6.50–11.6

Precipitation86.5 mm/mo 61.7–118

Air humidity61.9 % 60.3–66.1

Moisture balance5.80 mm/mo -67.1–53.7

Vapour deficit517 Pa 393–754

Wind speed4.20 m/s 2.80–5.20

Cloud cover51.4 % 40.8–63.8

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Taphrina betulina

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type7 840 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 840 records