Tanichthys micagemmae

Freyhof & Herder, 2001 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Tanichthys

At a glance

Occurrence records24

Data sources8

Biological traits4

DNA specimens7

eDNA detections8

Sources8 archives

Databases and archives Tanichthys micagemmae's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Tanichthys micagemmae is a species of freshwater ray-finned fish. It is a member of the carp family (family Cyprinidae) of order Cypriniformes. It was only discovered in 2001, in a tributary of the Bến Hải River in Quảng Bình Province, Vietnam. Its range includes what was the demilitarized zone between North and South Vietnam and was subject to intense bombing during the Vietnam War. It is similar in appearance to the White Cloud Mountain minnow (T. albonubes), the most familiar member of its genus, which is a commonly sold freshwater aquarium fish. T. micagemmae can be distinguished from its more familiar relative primarily by the lighter coloration of its lower body and by the centered position of its lateral stripes, compared with a position well above the middle in T. albonubes. Some older males develop spectacular elongated dorsal and anal fins. The species is sold in England under the common name Vietnamese cardinal minnow. It is known in Finnish as juovakardinaalikala (striped cardinal fish), kardinaalikala (cardinal fish) being the White Cloud Mountain minnow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length2.31 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tanichthys micagemmae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.44%

Haplotypes1

BIN1

Where individuals differ — all 10 variable positions, in barcode order

39Amostly conserved

111Tmostly conserved

138Cmostly conserved

169Cmostly conserved

213Amostly conserved

327Amostly conserved

366Gmostly conserved

387Cmostly conserved

390Tmostly conserved

447Tmostly conserved

CTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTTCTTATCCGGGCTGAATTAAGTCAACCCGGGTCGCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tanichthys albonubessame genus10.1%Spinibarbus hollandisame family14.0%Distoechodon tumirostrissame family14.3%Mylopharodon conocephalussame family14.4%Squalius anatolicussame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031631 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~10.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin10.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type24 records

Museum / vouchered24

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	21
FishBaselocation not on record	1
Stockholm, SE	1
SEAOBISlocation not on record	1

4 institutions · 24 of 24 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Tanichthys micagemmae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)