Tanacetum vulgare
speciesAt a glance
Occurrence records548 384
Data sources16
Biological traits63
DNA specimens42
eDNA detections23
Sources16 archives
Databases and archives Tanacetum vulgare's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility548 384 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources63 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS254 compounds
Occurrence & distributionGBIF548 384 records
Environmental DNA1 datasets · 7 countries23 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceCCDB · GoaT · NCBI5.1 Gbp
01Narrative
Illustration of a tansy Tansy (Tanacetum vulgare) is a perennial, herbaceous flowering plant in the genus Tanacetum in the aster family, native to temperate Europe and Asia. It has been introduced to other parts of the world, including North America, and in some areas has become invasive. It is also known as common tansy, bitter buttons, cow bitter, or golden buttons. The Latin word vulgare means "common".
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Fruit length1.5 mm
Leaf length250 mm
Leaf length max200 mm
Leaf mass428 mg
Leaf size4 750 mm²
⚠ sources differ — TRY: 4 750 mm² · LEDA: 8 376 mm² · GIFT: 8 376 mm²
Leaf width120 mm
⚠ sources differ — AusTraits: 120 mm · GIFT: 75 mm
Leaf width max250 mm
Leaf width min75 mm
Petiole length5 cm
Plant height0.468 m
⚠ sources differ — GIFT: 0.468 m · AusTraits: 1.1 m · LEDA: 0.825 m · TRY: 0.787 m
Plant height generative0.657 m
Plant height max1.5 m
Plant height min0.3 m
Seed length1.6 mm
Seed mass0.17 mg
⚠ sources differ — TRY: 0.17 mg · LEDA: 0.211 mg · GIFT: 0.247 mg
Seed mass max0.21 mg
Seed mass min0.1 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Life cycle & reproduction15
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: hydrochorous
Flowering endOct
Flowering startJul
Flowering timeyyyyynnnyyyy
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number7 133
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation mean1 325 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTCampo Limpo, Floresta Estacional Semidecidual
Leaf compoundnesssimple
Leaf shapeobovate ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio18.13 g/g
Leaf c468 mg/g
Leaf dry-matter content (LDMC)293 mg/g
⚠ sources differ — TRY: 293 mg/g · LEDA: 221 mg/g
Leaf n26.07 mg/g
Leaf p3.83 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.45 mm²/mg
⚠ sources differ — TRY: 21.45 mm²/mg · LEDA: 21.8 mm²/mg · GIFT: 20.61 mm²/mg
Wood density420 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition254 compounds
Compounds documented for Tanacetum vulgare across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented
Compound class profile5 classes
Germacrane sesquiterpenoids30
Flavones20
Acyclic monoterpenoids17
Thujane monoterpenoids13
Pinane monoterpenoids8
Documented compounds254 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| DAVANONE | 8,803 ppm | DukesPhytochem | |
| EO | 5,000 ppm | DukesPhytochem | |
| ISOTHUJONE | 4,050 ppm | DukesPhytochem | |
| BETA-THUJONE | 3,500 ppm | DukesPhytochem | |
| GERMACRENE-D | 2,000 ppm | DukesPhytochem | |
| CAMPHOR | 1,800 ppm | DukesPhytochem | |
| 1,8-CINEOLE | 1,300 ppm | DukesPhytochem | |
| TANACETOL-B | 1,100 ppm | DukesPhytochem | |
| SABINENE | 700 ppm | DukesPhytochem | |
| BETA-THUJYL-ALCOHOL | 435 ppm | DukesPhytochem |
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tanacetum vulgare has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes7
GenBank sequences10
eDNA detections23
Countries7
The DNA barcodea real sequence read deposited for this species
GCCCCGTTCGCGGTGTGCTCATGAGACGTGGCTTCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAA …
Tanacetum vulgare voucher KS23 HER0549 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL5★rbcLa★ITS3★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Tanacetum vulgare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 085 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Tanacetum vulgare5.09 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1883×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Hindáková M. & Činčura F., 1968: Angaben über die Zahl und Morphologie der Chromosomen einiger Pflanzenarten aus dem Territorium der Ostslowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 181-227.
CCDB · slov-fl — Murín A., 1993: Karyologické štúdium okrasných rastlín flóry Slovenska. - Biológia (Bratislava) 48/4: 441-445.
CCDB · slov-fl — Leskovjanská A., 2007: [New records in Cirsium, Eupatorium, Lapsana, Leontodon, Medicago, Melilotus, Plantago, Salvia, Senecio, Silene, Sonchus, Tanacetum, Thlaspi, Trifolium, and Veronica], pp. 195, 251, 355, 359, 384, 387, 453, 518, 536, 549, 555, 568, 582, 592, 603. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iapt
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4036
CCDB · fl-europaea — Majovsky et al., 1970
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Volkova, S. A. & D. D. Basargin. 2002. Chromosome numbers of species of Chabarovsk territory flora. Bot. Žhurn. (Moscow & Leningrad) 87(4): 165–167.
CCDB · ipcn-api-dl — Zhmyleva. 2006. Comparison of somatic chromosomes in some species of Chrysanthemum sensu lato in Russia. Chromosome Bot. 1: 13–22.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
CCDB · ipcn-api-dl — Sopova, M. & Z. Sekovski. 1982. Chromosome atlas of some Macedonian angiosperms. III. God. Zborn. Biol. Fak. Univ. Kiril Metod. 35: 145–161.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Honda, Y., A. E. M. Hussein, H. Ogura, K. Kondo, R. Tanaka & T. Shibahara. 1997. Counting sat-chromosome numbers and species characterization in wild species of Chrysanthemum sensu lato by fluorescent in situ hybridization using pTa71 probe. Chromosome Sci. 1: 77–82.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
+37 more references
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
2n 271×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
n 97×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Parfitt, B. D. & N. A. Harriman. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 515-516.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.7% BUSCO
07Deep time~5.1 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.1 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type548 384 records
Wild obs. + sensor536 716
Museum / vouchered10 769
Cultivated / captive87
Other812
Origin
Native6 374
Introduced295
Range
Area of Occupancy AOO682 280 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 175 743≤1 km 102 013≤10 km 165 190>10 km 4 374
447 320 georeferenced · 89 396 without coordinates
Open the mapobservation + sensor536 716
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 596≤1 km 1 860≤10 km 4 672>10 km 343
7 471 georeferenced · 3 298 without coordinates
Open the institutions mapphysical evidence10 769
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy11% within 1 km
≤100 m 1≤1 km 1≤10 km 5>10 km 12
19 georeferenced · 68 without coordinates
Open the mapnot free-living87
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions187 of 344 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 857 |
| Moscow State Universitylocation not on record | 330 |
| LDlocation not on record | 280 |
| Uniwersytet Warszawskilocation not on record | 212 |
| Madison, US | 165 |
| TROMlocation not on record | 146 |
| Trondheim, NO | 129 |
| Philadelphia, US | 127 |
| Olocation not on record | 124 |
| Oulu, FI | 119 |
| Görlitz, DE | 111 |
| Oskarshamn, SE | 106 |
| Bergen, NO | 106 |
| Jyväskylä, FI | 103 |
| Chongqing Museumlocation not on record | 94 |
| Turku, FI | 86 |
| St. Paul, US | 84 |
| Spearfish, US | 84 |
| Salzburg, AT | 82 |
| Kuopio, FI | 73 |
| Québec, CA | 73 |
| Berlin, DE | 71 |
| WTUlocation not on record | 71 |
| Adam Mickiewicz University in Poznańlocation not on record | 70 |
| SLU Artdatabankenlocation not on record | 70 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 65 |
| Bronx, US | 64 |
| BFLlocation not on record | 58 |
| Bern, CH | 56 |
| Montréal, CA | 56 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 50 |
| Ann Arbor, US | 48 |
| KMNlocation not on record | 45 |
| Pullman, US | 44 |
| Uniwersytet Opolskilocation not on record | 44 |
| Karlsruhe, DE | 43 |
| Moscow, US | 41 |
| Mount Annan, AU | 39 |
| Wuzhou, CN | 39 |
| Tartu, EE | 39 |
| BDBClocation not on record | 38 |
| Burlington, US | 36 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 36 |
| Provincia di Livornolocation not on record | 35 |
| University of New Hampshirelocation not on record | 35 |
| Barcelona, ES | 34 |
| Acadia Universitylocation not on record | 34 |
| Tula State Universitylocation not on record | 32 |
| Saint John, CA | 31 |
| BRNUlocation not on record | 30 |
| Université Lavallocation not on record | 29 |
| Mlocation not on record | 29 |
| South Kensington, GB | 28 |
| Missoula, US | 27 |
| Vancouver, CA | 27 |
| Corvallis, US | 26 |
| Adelaide, AU | 25 |
| Tallinn, EE | 25 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 25 |
| Zürich, CH | 25 |
| Uppsala, SE | 23 |
| Porvoo, FI | 23 |
| Helsinki, FI | 23 |
| Green Bay, US | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Bozeman, US | 21 |
| Canberra, AU | 21 |
| Allentown, US | 21 |
| Entomological Society of Latvialocation not on record | 20 |
| Bloomington, US | 20 |
| Christchurch, NZ | 20 |
| Zürich, CH | 20 |
| València, ES | 18 |
| Saint Louis, US | 17 |
| Dekalb, US | 17 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 15 |
| Auckland, NZ | 15 |
| Logan, US | 14 |
| MAlocation not on record | 14 |
| Kandalaksha State Nature Reservelocation not on record | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| Santa Barbara, US | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| University of Alberta Museumslocation not on record | 12 |
| BClocation not on record | 12 |
| Chadron, US | 12 |
| Boise, US | 12 |
| Victoria, CA | 12 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 12 |
| Frankfurt am Main | 11 |
| WINlocation not on record | 11 |
| Hobart, AU | 11 |
| Portland, US | 10 |
| TUR-Alocation not on record | 10 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 10 |
| Canadian Department of Agriculturelocation not on record | 9 |
| Tilburg, NL | 9 |
| Porrentruy, CH | 9 |
| Rovaniemi, FI | 9 |
| Davenport, US | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Vitoria, ES | 8 |
| Toronto, CA | 8 |
| Stockholm, SE | 8 |
| Wlocation not on record | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Emporia, US | 8 |
| University of Stellenboschlocation not on record | 7 |
| UNESClocation not on record | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Denver, US | 7 |
| GJOlocation not on record | 7 |
| CICYTEXlocation not on record | 7 |
| Madrid, ES | 7 |
| Salamanca, ES | 7 |
| Alicante, ES | 7 |
| Keene State Universitylocation not on record | 7 |
| Davis, US | 7 |
| Hudson, US | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| Staten Island, US | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Forssa, FI | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 6 |
| Bourges, FR | 6 |
| IDElocation not on record | 6 |
| Kyoto Universitylocation not on record | 6 |
| Garðabær, IS | 6 |
| UGentlocation not on record | 6 |
| Anchorage, US | 6 |
| Whitewater, US | 6 |
| Philadelphia, US | 6 |
| Columbia, US | 6 |
| Claremont, US | 6 |
| College Park, US | 6 |
| BGBMlocation not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| UFOPlocation not on record | 5 |
| Pamplona, ES | 5 |
| Urumqi, CN | 5 |
| USFS/BHSClocation not on record | 5 |
| Cheney, US | 5 |
| Caldwell, US | 5 |
| Brisbane, AU | 5 |
| Tacoma, US | 5 |
| Laboratory of Palaeontologylocation not on record | 5 |
| CASlocation not on record | 5 |
| Riverside, US | 5 |
| Córdoba, AR | 4 |
| Williamsburg, US | 4 |
| WNNUlocation not on record | 4 |
| Armidale, AU | 4 |
| Pamplona, ES | 4 |
| Rotorua, NZ | 4 |
| Criciúma, BR | 4 |
| Dresden, DE | 4 |
| Bangkok, TH | 4 |
| Flagstaff, US | 4 |
| Albuquerque, US | 4 |
| Paris, FR | 4 |
| Beijing, CN | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Pocatello, US | 4 |
| Ivano-Frankivsk, UA | 4 |
| Wellington, NZ | 4 |
| CJBGlocation not on record | 4 |
| Maringá, BR | 4 |
| Bothell, US | 3 |
| McWane Science Centerlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Fulda, DE | 3 |
| 3 | |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Granada, ES | 3 |
| Cenargenlocation not on record | 3 |
| San Isidro, AR | 3 |
| National Museum Waleslocation not on record | 3 |
| Chicago, US | 3 |
| Xiamen, CN | 3 |
| Phoenix, US | 3 |
| PRClocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Mississippi State, US | 3 |
| San Sebastián, ES | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| QVMAGlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Provo, US | 3 |
| Yangling, CN | 3 |
| Whitehorse, CA | 3 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 3 |
| Brasília, BR | 3 |
| San Luis Obispo, US | 3 |
| Frauenfeld, CH | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Trois-Rivières, CA | 3 |
| Hamilton, US | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Kew, GB | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Kunming, CN | 3 |
| BSBIlocation not on record | 3 |
| Millersville, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Castelar, AR | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Orem, US | 2 |
| CZE061location not on record | 2 |
| Pittsburg, US | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Salvador, BR | 2 |
| Elocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| nbflocation not on record | 2 |
| EL PASO, US | 2 |
| Taipei, TW | 2 |
| Knoxville, US | 2 |
| Mohonk Preservelocation not on record | 2 |
| Chicago, US | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Tsukuba, JP | 2 |
| GZUlocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Sion, CH | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Winterthur, CH | 2 |
| Guangzhou, CN | 2 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 2 |
| Northeastern Forestry Universitylocation not on record | 2 |
| San Diego, US | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Northridge, US | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 2 |
| Odawara, JP | 2 |
| FLADlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| New Brunswick, US | 2 |
| Grand Junction, US | 1 |
| Zhengzhou, CN | 1 |
| Naturkundliche Sammlung Urilocation not on record | 1 |
| Morgantown, US | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Xian, CN | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| GB | 1 |
| FLASlocation not on record | 1 |
| Minia, EG | 1 |
| EEZA-CSIClocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Göteborg, SE | 1 |
| Angwin, US | 1 |
| Durham, US | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Chaguaramas, TT | 1 |
| Clemson, US | 1 |
| ISAlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Palmerston North, NZ | 1 |
| UNICAMPlocation not on record | 1 |
| Durango, US | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Jackson, US | 1 |
| Ypsilanti, US | 1 |
| GAlocation not on record | 1 |
| JBAlocation not on record | 1 |
| DULlocation not on record | 1 |
| Urumqi, CN | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Kingston, US | 1 |
| New Haven, US | 1 |
| University of Lethbridgelocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Austin, US | 1 |
| Fredericksburg, US | 1 |
| Arcata, US | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Philadelphia, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| HUN003location not on record | 1 |
| Lake Charles, US | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Valparaiso, CL | 1 |
| Bend, US | 1 |
| Ashland, US | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Wollongong, AU | 1 |
| Tromso University Museumlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Corrientes, AR | 1 |
| Chapel Hill, US | 1 |
| Western Carolina Universitylocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Namur, BE | 1 |
| Campo Mourão, BR | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Glarus, CH | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Nijmegen, NL | 1 |
| Pelotas, BR | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| University of Wisconsinlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| JMSlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Fribourg, CH | 1 |
| Guilin, CN | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| San Jose, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Chicago, US | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Lanzhou, CN | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| ROM007location not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Waverly, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Banyoles, ES | 1 |
344 institutions · 9 381 of 10 769 vouchered records shown · 989 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Tanacetum vulgare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map7 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 10.0–19.1
Seasonal swing summer↔winter14.8 °C
Max temp (day)18.2 °C 13.5–22.0
Min temp (night)11.4 °C 4.90–15.3
Precipitation78.6 mm/mo 55.9–119
Air humidity62.4 % 58.3–65.0
Moisture balance1.50 mm/mo
Vapour deficit659 Pa 495–848
Wind speed4.70 m/s
Cloud cover50.6 % 38.9–58.1
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.