Taiwanofungus camphoratus

(M.Zang & C.H.Su) Sheng H.Wu, Z.H.Yu, Y.C.Dai & C.H.Su · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Fomitopsidaceae/Taiwanofungus

At a glance

Occurrence records105

Data sources9

Biological traits0

DNA specimens38

eDNA detections123

Sources9 archives

Databases and archives Taiwanofungus camphoratus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS267 compounds

Occurrence & distributionGBIF105 records

Environmental DNA2 datasets · 3 countries123 detections

DNA & barcodingBOLD · NCBI38 specimens

Genome at a glanceNCBI≈33 Mbp

01Narrative

Antrodia cinnamomea is a fungus species described as new to science in 1995. It causes brown heart rot of the aromatic tree Cinnamomum kanehirae. It is used in Taiwanese traditional medicine as a supposed remedy for cancer, hypertension, and hangover. The annual market is worth over $100 million (US) in Taiwan alone. The 32.15 Mb genome containing 9,254 genes has been sequenced. Antrodia cinnamomea has been found to produce anti-obesogenic, anti-inflammatory and antidiabetic effects in high-fat diet-fed mice.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition267 compounds

Compounds documented for Taiwanofungus camphoratus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ergostane steroids102

Prenyl quinone meroterpenoids36

Lanostane, Tirucallane and Euphane triterpenoids22

Cholestane steroids $ Ergostane steroids12

Stigmastane steroids7

Documented compounds267 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Antroquinonol;(4R,5R,6R)-(+)-Antroquinonol;Antroquinonol	present	LOTUS
(14alpha,22e)-14-Hydroxyergosta-7,22-diene-3,6-dione	present	LOTUS
(1R,2R,5R,6R,9R,10R,13S,15R)-5-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-6,10-dimethyl-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadec-18-en-13-ol	present	LOTUS
(1S,2R,5R,6R,9R,10R,13S,15S)-5-[(E,2S,5R)-5,6-dimethylhept-3-en-2-yl]-6,10-dimethyl-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadec-18-en-13-ol	present	LOTUS
(25S)-Antcin B	present	LOTUS
(2E,4S,6E,10E)-12-[(1R,2R,6R)-2-acetyloxy-3,4-dimethoxy-6-methyl-5-oxocyclohex-3-en-1-yl]-4-hydroxy-2,6,10-trimethyldodeca-2,6,10-trienoic acid	present	LOTUS
(2R)-2-[(5R,10S,13R,14R,15S,17R)-15-hydroxy-4,4,10,13,14-pentamethyl-3-oxo-1,2,5,6,12,15,16,17-octahydrocyclopenta[a]phenanthren-17-yl]-6-methyl-5-methylideneheptanoic acid	present	LOTUS
(2R,5R,9S)-9-acetyl-9-hydroxy-2,7,8-trimethyl-2-[(4R,8R)-4,8,12-trimethyltridecyl]-1-oxaspiro[4.4]non-7-en-6-one	present	LOTUS
(2R,6R)-2-methyl-3-methylidene-6-[(3R,4R,5R,7S,10S,13R,14R,17R)-3,4,7-trihydroxy-4,10,13-trimethyl-11-oxo-2,3,5,6,7,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]heptanoic acid	present	LOTUS
(2R,6R)-2-methyl-3-methylidene-6-[(3R,4S,5S,7S,10S,12R,13R,14R,17R)-3,7,12-trihydroxy-4,10,13-trimethyl-11-oxo-1,2,3,4,5,6,7,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl]heptanoic acid	present	LOTUS

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taiwanofungus camphoratus has left across the world's sequence archives.

At a glance

DNA specimens38

Marker genes2

GenBank sequences10

eDNA detections123

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW377328.1 ↗472 bpChina

ACGT

TCTAGAAGAGACTGCGGAGGTCATTATTGTATTTGAAAGGGGTTGTAGCTGACCTCCTCTTGAAAAGGGGGGAGGTATGTGCACACCTCT …

Taiwanofungus camphoratus voucher Cui 17235 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Taiwanofungus camphoratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 045 214 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Taiwanofungus camphoratus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type105 records

Wild obs. + sensor3

Museum / vouchered102

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 102 records without

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Museum of Natural Sciencelocation not on record	1

1 institutions · 1 of 102 vouchered records shown · 91 without an institution code

09Environmental DNA123 detections

Where the DNA of Taiwanofungus camphoratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.5 °C 16.0–25.0

pH6.30 3.80–8.76

Conductivity52.5 µS/cm 10.0–1,500

Organic carbon1.20 % 0.07–5.08

Water content6.43 % 0.305–34.1

Nitrate-N5.30 mg/kg 1.00–53.0

Phosphorus15.0 mg/kg 2.00–590

Clay11.8 % 2.88–60.6

Sand83.0 % 23.0–97.1

Depth0 m 0–0.2

MarineSoilRudosolChromosolsLatLon out of rangeKandosolSodosolDermosol

83 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 12.7–25.5

Seasonal swing summer↔winter10.4 °C

Max temp (day)22.0 °C 16.6–30.1

Min temp (night)13.2 °C 7.90–19.9

Precipitation47.7 mm/mo 12.8–328

Air humidity56.5 % 45.4–65.8

Moisture balance-81.5 mm/mo -149–229

Vapour deficit848 Pa 613–1,610

Wind speed3.60 m/s 1.40–4.90

Cloud cover23.8 % 11.0–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 96 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)