Tadehagi triquetrum

(L.) H.Ohashi · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Tadehagi

At a glance

Occurrence records859

Data sources12

Biological traits15

DNA specimens13

eDNA detections13

Sources12 archives

Databases and archives Tadehagi triquetrum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility859 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF859 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 22

01Narrative

The Trefle Gros, (Tadehagi triquetrum), is a species of flowering plant in the legume family, Fabaceae. It belongs to the subfamily Faboideae. The species has two subspecies with the nominate one, but sometimes they given full species status by some authors. The maximum height of this shrub tree is 3m. Leaves alternate, linear-oblong, ovate with a tapering tip. Flowers show raceme inflorescence type, which are small, pale purplish in color. The fruit is a hairy legume. It is widespread in all South Asian, East Asian, and Southeast Asian countries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height2 m

Plant height max1 m

Seed mass2.71 mg

Life cycle & reproduction2

Life formscrambling perennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min600 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition64 compounds

Compounds documented for Tadehagi triquetrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Tetrodotoxins4

Dihydroflavonols4

Stigmastane steroids3

Flavonols3

Cinnamic acids and derivatives3

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1R,2S,3S,4S,5R,9S,11S,12S,14R)-7-amino-2-(hydroxymethyl)-10,13,15-trioxa-6,8-diazapentacyclo[7.4.1.13,12.05,11.05,14]pentadec-7-ene-2,4,12-triol	present	NPASS
(1R,5R,6R,7R,9S,11S,12S,13S,14S)-3-amino-14-methyl-8,10-dioxa-2,4-diazatetracyclo[7.3.1.17,11.01,6]tetradec-3-ene-5,9,12,13,14-pentol	present	NPASS
(1R,5R,6S,8R,9S,12S,13S)-3-amino-5,8,12,13-tetrahydroxy-8-(hydroxymethyl)-10-oxa-2,4-diazatricyclo[7.3.1.01,6]tridec-3-en-11-one	present	NPASS
(2R,3S)-2-(3,4-Dihydroxyphenyl)-3,5,7-Trihydroxy-2,3-Dihydrochromen-4-One	present	NPASS
(3R)-3-(3,5-dihydroxy-4-methoxyphenyl)-3-[(3R)-3-(3,5-dihydroxy-4-methoxyphenyl)-5-hydroxy-8,8-dimethyl-4-oxo-2H-pyrano[2,3-h]chromen-3-yl]-5-hydroxy-8,8-dimethyl-2H-pyrano[2,3-h]chromen-4-one	present	LOTUS
(3S)-3-(3,4-dihydroxyphenyl)-5-hydroxy-8,8-dimethyl-2,3-dihydropyrano[2,3-h]chromen-4-one	present	LOTUS
(4R,7S,7aS)-1,2,3,4,7,7a-Hexahydro-2,4,7-trimethyl-6H-cyclopenta(c)pyridin-6-one	present	NPASS
3,5-Dihydroxyphenyl beta-D-glucopyranoside	present	NPASS
4-Coumaric acid	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tadehagi triquetrum has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections13

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOP763752.1 ↗360 bpBangladesh · 2020

ACGT

CCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCATGCCTGCCTGGGTGTCACACTCCGTTACCCTC …

Tadehagi triquetrum voucher 18R 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tadehagi triquetrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–222n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 226×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · ipcn-api-dl — Gao, C. z. & Q. l. Zou. 1995. A report on the karyotypes and chromosome numbers of some taxa of Desmodium (sensu lat.) from Guangxi. Guihaia 15(2): 166–171.

CCDB · eflora

CCDB · book-atlas-flowering-plants — FoH

n 113×CCDB · ipcn-api-dl · CCDB · Cannon, 2015

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · Cannon, 2015 — Yeh, M.S., H. Yuasa & F. Maekawa., 1986

CCDB · Cannon, 2015 — Bairiganjan, G. C. & S. N. Patnaik, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type859 records

Wild obs. + sensor143

Museum / vouchered497

Cultivated / captive69

Other150

Range

Area of Occupancy AOO1 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 61≤1 km 22≤10 km 15>10 km 13

111 georeferenced · 32 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 7≤1 km 2≤10 km 22>10 km 4

35 georeferenced · 462 without coordinates

Open the institutions mapphysical evidence497

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 68 without coordinates

Open the mapnot free-living69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	103
Guangzhou, CN	99
Guilin, CN	84
Chengdu, CN	17
Xiamen, CN	14
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	14
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	13
Kew, GB	12
Baroda, IN	8
Brisbane, AU	6
Edinburgh, GB	5
Kunming, CN	5
Museo Entomologico de Leonlocation not on record	5
Moscow State Universitylocation not on record	5
FJIDClocation not on record	5
云南省思茅市民族传统医药研究所location not on record	5
Jiangxi Universitylocation not on record	5
Yunnan Universitylocation not on record	5
Seoul, KR	4
LDlocation not on record	4
Paris, FR	4
Guiyang, CN	4
Bronx, US	2
Southwest Forestry Collegelocation not on record	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Changsha, CN	2
Kagoshima, JP	1
Stockholm, SE	1
Wuhan, CN	1
Fujian Institute of Subtropical Botanylocation not on record	1
University of Stellenboschlocation not on record	1
MeiseBGlocation not on record	1
CASlocation not on record	1
hitbclocation not on record	1
Uppsala, SE	1
NGCPR01758location not on record	1
NGCPR01757location not on record	1
Taipei, TW	1
FJFClocation not on record	1
Zhuzhou, CN	1
Smithfield, AU	1

41 institutions · 449 of 497 vouchered records shown · 47 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Tadehagi triquetrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.5–26.5

Seasonal swing summer↔winter6.60 °C

Max temp (day)29.8 °C

Min temp (night)21.8 °C

Precipitation107 mm/mo

Air humidity60.1 %

Moisture balance-40.6 mm/mo

Vapour deficit1,379 Pa

Wind speed2.40 m/s

Cloud cover48.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)