Tacinga werneri

(Eggli) N.P.Taylor & Stuppy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Tacinga

At a glance

Occurrence records82

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Tacinga werneri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF82 records

DNA & barcodingNCBIsequences

01Narrative

Tacinga werneri is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitats are subtropical or tropical dry forests and hot deserts. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTCaatinga (stricto sensu), Floresta Estacional Decidual, Floresta Estacional Semidecidual, Vegetação Sobre Afloramentos Rochosos

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacinga werneri has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMT304108.1 ↗708 bp

ACGT

AACTAAAGCAAGTGTTGGATTTAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCCGAATATCAACCCCAGGATACCGATAT …

Tacinga werneri isolate NE840 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type82 records

Wild obs. + sensor16

Museum / vouchered65

Other1

Origin

Native36

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 8≤1 km 1≤10 km 2

11 georeferenced · 5 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 65 records without

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	20
Feira de Santana, BR	9
Cruz das Almas, BR	7
UnBlocation not on record	7
Kew, GB	6
JBRJlocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	2
USP-IBlocation not on record	2
UFSCarlocation not on record	2
Universidade Federal do Vale do São Franciscolocation not on record	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Salvador, BR	1
UNICAMPlocation not on record	1
Chaguaramas, TT	1
UFRPElocation not on record	1
UESBlocation not on record	1

16 institutions · 65 of 65 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)