Tacinga palmadora

(Britton & Rose) N.P.Taylor & Stuppy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Tacinga

At a glance

Occurrence records558

Data sources10

Biological traits18

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Tacinga palmadora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility558 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF558 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Tacinga palmadora is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry shrubland. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length30 mm

Fruit length max30 mm

Fruit length min30 mm

Plant height max4 m

Life cycle & reproduction4

Dehiscenceindehiscent

Dispersal typeanimal

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Habitat GIFTCaatinga (stricto sensu), Carrasco, Vegetação Sobre Afloramentos Rochosos

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacinga palmadora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF787028.1 ↗577 bp

ACGT

TCGAAACCTGCCCAGCAGAAAGACCCGCGAACATGTTCTCCCATGAACACGCGGGGAGGGGCGCCTCTGCCCCCTCCCCGGCGCAACAAC …

Tacinga palmadora voucher DBG:0392 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tacinga palmadora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · iapt

CCDB · iapt

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type558 records

Wild obs. + sensor160

Museum / vouchered398

Origin

Native200

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 26≤1 km 12≤10 km 9>10 km 1

48 georeferenced · 112 without coordinates

Open the mapobservation + sensor160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 396 without coordinates

Open the institutions mapphysical evidence398

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	61
Universidade Federal do Vale do São Franciscolocation not on record	38
Universidade Federal do Rio Grande do Nortelocation not on record	33
Kew, GB	27
Chaguaramas, TT	22
UNIVASFlocation not on record	22
Feira de Santana, BR	21
Departamento de Sistematica e Ecologialocation not on record	20
Universidade Federal de Sergipe (UFS)location not on record	20
UFBAlocation not on record	18
Cruz das Almas, BR	18
JBRJlocation not on record	13
CEPLAClocation not on record	12
Bronx, US	11
UFPElocation not on record	9
UFRPElocation not on record	6
CPATSAlocation not on record	6
Salvador, BR	6
Ilhéus, BR	5
UESBlocation not on record	4
USP-IBlocation not on record	3
HACAMlocation not on record	2
UnBlocation not on record	2
IPA/SPlocation not on record	2
Teresina, BR	2
MUFALlocation not on record	2
Fortaleza, BR	1
Santa Teresa, BR	1
INMAlocation not on record	1
UFPRlocation not on record	1
UFABClocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
Ivano-Frankivsk, UA	1
UNESP-RClocation not on record	1
CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record	1
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	1

38 institutions · 397 of 398 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Tacinga palmadora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)