Tacinga inamoena

(K.Schum.) N.P.Taylor & Stuppy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Tacinga

At a glance

Occurrence records1 441

Data sources10

Biological traits10

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Tacinga inamoena's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 441 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 441 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Tacinga inamoena is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical dry shrubland, and rocky areas. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyte detailedterrestrial

Growth form detailedshrub

Habitat GIFTCaatinga (stricto sensu), Campo Rupestre, Carrasco, Vegetação Sobre Afloramentos Rochosos

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacinga inamoena has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSJF787026.1 ↗368 bp

ACGT

GAACCTGCCCAGCAGAAAGACCCGCGAACATGTTCTCCCATGAACACGCGGGGAGGGGCGCCTCTGCCCCCTTCCTGGCGCAACAACAAA …

Tacinga inamoena voucher 3849 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tacinga inamoena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–662n range44median44mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · iapt

CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 28

2n 661×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — YUASA, H., H. SHIMIZU, S. KASHIWAI, & N. KONDO. 1974. Chromosome numbers and their bearing on the geographic distribution in the subfamily Opuntioideae (Cactaceae). Rep. Inst. Breed. Research, Tokyo Univ. Agri. No. 4: 1-10.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 441 records

Wild obs. + sensor770

Museum / vouchered670

Other1

Origin

Native368

Range

Area of Occupancy AOO2 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 68≤1 km 25≤10 km 21>10 km 15

129 georeferenced · 641 without coordinates

Open the mapobservation + sensor770

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 669 without coordinates

Open the institutions mapphysical evidence670

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	111
Universidade Federal do Vale do São Franciscolocation not on record	81
Feira de Santana, BR	53
UFBAlocation not on record	40
Departamento de Sistematica e Ecologialocation not on record	38
Universidade Federal do Rio Grande do Nortelocation not on record	35
UNIVASFlocation not on record	30
Kew, GB	30
Chaguaramas, TT	27
Universidade Federal do Ceara, Departamento de Biologialocation not on record	20
USP-IBlocation not on record	15
Cruz das Almas, BR	14
Fortaleza, BR	14
UFRPElocation not on record	14
Bronx, US	14
Universidade Federal de Sergipe (UFS)location not on record	13
Salvador, BR	13
CEPLAClocation not on record	11
JBRJlocation not on record	11
Ilhéus, BR	10
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	8
UESBlocation not on record	6
UFMGlocation not on record	6
HACAMlocation not on record	6
UNICAMPlocation not on record	5
URCAlocation not on record	4
Universidade Federale do Rio Grande do Sullocation not on record	4
UFSCarlocation not on record	3
UnBlocation not on record	3
CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record	3
UFPElocation not on record	3
Departamento de Geologia, Universidad de Chilelocation not on record	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	2
Teresina, BR	2
UFPRlocation not on record	2
UFERSAlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Museu Paraense Emílio Goeldilocation not on record	2
CPATSAlocation not on record	2
UNESP-FCAlocation not on record	1
UFSClocation not on record	1
ESALQlocation not on record	1
VALElocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
FUNEDlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
FPMZBlocation not on record	1

47 institutions · 669 of 670 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Tacinga inamoena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tacinga inamoena

At a glance

Sources10 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment7

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 441 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 47 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 441 records