Tacinga funalis

Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Tacinga

At a glance

Occurrence records89

Data sources11

Biological traits11

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Tacinga funalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tacinga funalis is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry shrubland. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

Habitat GIFTCaatinga (stricto sensu), Carrasco

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacinga funalis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

matKAY042660.1 ↗839 bp

ACGT

CATTTAAATTATGTGTTAAAAATATTAATACCTTACCCCATTCATCTAGAAATCTTGGTTCAAACTCTTCGTTACTGGGTGAAAGATGCT …

Tacinga funalis maturase K (matK) gene, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tacinga funalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · iapt · CCDB · book-ipcn73-74

CCDB · iapt

CCDB · book-ipcn73-74 — YUASA, H., H. SHIMIZU, S. KASHIWAI, & N. KONDO. 1974. Chromosome numbers and their bearing on the geographic distribution in the subfamily Opuntioideae (Cactaceae). Rep. Inst. Breed. Research, Tokyo Univ. Agri. No. 4: 1-10.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type89 records

Wild obs. + sensor9

Museum / vouchered80

Origin

Native37

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 2≤1 km 1≤10 km 4

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 80 records without

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	16
Kew, GB	13
Universidade Federal do Vale do São Franciscolocation not on record	7
Cruz das Almas, BR	6
Feira de Santana, BR	6
UFBAlocation not on record	4
Universidade Federal do Rio Grande do Nortelocation not on record	4
USP-IBlocation not on record	3
CEPLAClocation not on record	3
JBRJlocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	2
UFPRlocation not on record	2
Fortaleza, BR	1
UnBlocation not on record	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Ilhéus, BR	1
UNIVASFlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1
UFRPElocation not on record	1
UESBlocation not on record	1
UNESP-RClocation not on record	1
Brasília, BR	1

23 institutions · 80 of 80 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Tacinga funalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)