Tacca integrifolia

Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Dioscoreales/Dioscoreaceae/Tacca

At a glance

Occurrence records185

Data sources12

Biological traits30

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Tacca integrifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS67 compounds

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Tacca integrifolia, la « plante chauve-souris blanche », est une espèce de plantes herbacées du genre Tacca, de la famille des Taccaceae selon la classification classique, ou des Dioscoreaceae selon la classification phylogénétique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length45 mm

Fruit length max50 mm

Fruit length min40 mm

Leaf length530 mm

Leaf length max560 mm

Leaf length min500 mm

Leaf width198 mm

Leaf width max210 mm

Leaf width min185 mm

Plant height0.377 m

Plant height max1 m

Seed mass2.1 mg

Seed mass max2.1 mg

Seed mass min2.1 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max850 m

Elevation mean825 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf n20.5 mg/g

Specific leaf area (SLA)30.58 mm²/mg

03Chemical composition67 compounds

Compounds documented for Tacca integrifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Aminoacids20

Ergostane steroids12

Cycloartane triterpenoids9

Cholestane steroids $ Stigmastane steroids5

Cholestane steroids $ Ergostane steroids3

Documented compounds67 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Valine	present	LOTUS
(1R,3R,6S,7S,8R,11R,12S,15R,16R)-15-[(2R,5R)-5,6-dimethylheptan-2-yl]-7,12,16-trimethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15R)-6-[(2R,5R)-5,6-dimethylheptan-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15R)-6-[(2R,5S)-5,6-dimethylheptan-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15R)-6-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15R)-6-[(E,2R,5S)-5,6-dimethylhept-3-en-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15S)-5,9-dimethyl-6-[(2R,5R)-6-methyl-5-propan-2-ylhept-6-en-2-yl]pentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15S)-6-[(2R,5R)-5,6-dimethylheptan-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15S)-6-[(2R,5S)-5,6-dimethylheptan-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS
(1R,5R,6R,9S,10S,13S,15S)-6-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-5,9-dimethylpentacyclo[11.4.1.01,13.02,10.05,9]octadec-2-en-15-ol	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacca integrifolia has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJF978876.1 ↗720 bpChina

ACGT

GAGACACGAGATCGAAGCAAGACGAGCGAACTCGTAATCACCGACGATCTCGGAGCGATGGGGGTGCACGAGCGGCGTCGGCCGTGAGGC …

Tacca integrifolia voucher ZL007 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tacca integrifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.

CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol2 — Sharma, A. & Sarkar, A.K. 1967- 1968

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type185 records

Wild obs. + sensor62

Museum / vouchered123

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 19≤1 km 18≤10 km 8>10 km 1

46 georeferenced · 16 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤1 km 17≤10 km 5

22 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	34
Beijing, CN	10
Kew, GB	4
Saint Louis, US	3
Kunming, CN	2
Cibinong Science Center, Herbarium Bogorienselocation not on record	2
Edinburgh, GB	2
Bronx, US	1
Chengdu, CN	1
Cambridge, US	1
Xiamen, CN	1
Nanjing, CN	1
云南省思茅市民族传统医药研究所location not on record	1

13 institutions · 63 of 123 vouchered records shown · 56 without an institution code

09Environmental DNA10 detections

Where the DNA of Tacca integrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 10.0–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 15.7–30.4

Min temp (night)22.0 °C 3.10–22.6

Precipitation269 mm/mo 13.8–309

Air humidity68.1 % 45.7–68.8

Moisture balance133 mm/mo -95.2–162

Vapour deficit1,043 Pa 827–1,080

Wind speed1.20 m/s 0.7–4.50

Cloud cover49.9 % 24.1–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)