Tacca bibracteata

Drenth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Dioscoreales/Dioscoreaceae/Tacca

At a glance

Occurrence records26

Data sources7

Biological traits8

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Tacca bibracteata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF26 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Tacca bibracteata is a plant in the Dioscoreaceae family, native to Sarawak. It was first described by Engbert Drenth in 1908.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tacca bibracteata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK144508.1 ↗721 bp

ACGT

GGATCATTGTCGAGACTCGAGACCGAAGCAAGACAAGCGAATTCGTAATCGACCTCGAAGCGAAGGGGGTGCGTGAGGCAATGCCATGCC …

Tacca bibracteata voucher SAR:TA96 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor2

Museum / vouchered24

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	11
Cibinong Science Center, Herbarium Bogorienselocation not on record	4
Bronx, US	1

3 institutions · 16 of 24 vouchered records shown · 8 without an institution code

09Environmental DNA4 detections

Where the DNA of Tacca bibracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)