Tabernanthe iboga

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernanthe

At a glance

Occurrence records598

Data sources13

Biological traits16

DNA specimens2

eDNA detections2

Sources13 archives

Databases and archives Tabernanthe iboga's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility598 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionDukesPhytochem · LOTUS44 compounds

Occurrence & distributionGBIF598 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tabernanthe iboga (iboga) is a perennial rainforest shrub native to Central Africa. An evergreen bush indigenous to Gabon, the Democratic Republic of Congo, and the Republic of Congo, it is cultivated across Central Africa. In African traditional medicine and rituals, the yellowish root or bark is used to produce hallucinations and near-death outcomes, with some fatalities occurring. In high doses, ibogaine is considered to be toxic, and has caused serious comorbidities when used with opioids or prescription drugs. The United States Drug Enforcement Administration (DEA) lists ibogaine as a controlled substance of the Controlled Substances Act.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.5 m

Life cycle & reproduction5

Flowering endvariable

Flowering startvariable

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits2

Fruiting endvariable

Fruiting startvariable

03Chemical composition44 compounds

Compounds documented for Tabernanthe iboga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile4 classes

Iboga type16

Aspidosperma type2

Corynanthe type $ Yohimbine-like alkaloids1

Aspidosperma type $ Corynanthe type $ Strychnos type1

Documented compounds44 total

Tissue Source Quantified only

Compound	Class	Amount	Source
ALKALOIDS		60,000 ppm	DukesPhytochem

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernanthe iboga has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAJ419763.1 ↗1 470 bp

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACGGATATCTTGGCAGC …

Tabernanthe iboga chloroplast partial rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, specimen voucher Leeuwenberg 12544, WAG

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tabernanthe iboga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1959

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

CCDB · book-fedorov — Mangenot S., Mangenot G. 1958, 196~

CCDB · Cave1959 — Mang. & Mang. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type598 records

Wild obs. + sensor14

Museum / vouchered584

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 2≤1 km 5≤10 km 1

8 georeferenced · 6 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 5>10 km 2

8 georeferenced · 576 without coordinates

Open the institutions mapphysical evidence584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LBVlocation not on record	78
Saint Louis, US	67
Herbier National du Gabonlocation not on record	55
MeiseBGlocation not on record	43
WAGlocation not on record	31
BRLUlocation not on record	22
Plocation not on record	15
Yaoundé, CM	14
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	12
Kew, GB	12
Brussels, BE	10
IPHAMETRAlocation not on record	8
Paris, FR	4
South Kensington, GB	4
Coimbra, PT	2
Stockholm, SE	2
Zürich, CH	2
MAlocation not on record	2
Edinburgh, GB	2
University of Stellenboschlocation not on record	2
Tampa, US	1
Chongqing Museumlocation not on record	1
Philadelphia, US	1
Llocation not on record	1
Pretoria, ZA	1
CJBGlocation not on record	1
IFAN Ch. A. Dioplocation not on record	1
University of Santo Tomas Museumlocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
Boise, US	1

30 institutions · 397 of 584 vouchered records shown · 187 without an institution code

09Environmental DNA2 detections

Where the DNA of Tabernanthe iboga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter15.0 °C

Max temp (day)13.5 °C

Min temp (night)6.40 °C

Precipitation69.6 mm/mo

Air humidity63.8 %

Moisture balance-0.5 mm/mo

Vapour deficit484 Pa

Wind speed4.50 m/s

Cloud cover43.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)