Tabernaemontana stapfiana

Britten · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records399

Data sources7

Biological traits26

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Tabernaemontana stapfiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS20 compounds

Occurrence & distributionGBIF399 records

DNA & barcodingNCBIsequences

01Narrative

Tabernaemontana stapfiana (commonly known as soccerball fruit) is a medium-sized tree in the family Apocynaceae. Its flowers feature white with yellow-throated corolla lobes. The fruit is fleshy grey-green, in pairs, each up to 20 cm in diameter and weighing up to several kilograms. Its habitat is montane evergreen forests from 700 – altitude. The plant is native to an area of Africa from Uganda south to Mozambique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height22.5 m

⚠ sources differ — GIFT: 22.5 m · TRY: 15.31 m

Plant height min5 m

Seed mass208 mg

Seed mass max208 mg

Seed mass min208 mg

Seed volume230 mm³

Seed volume max230 mm³

Seed volume min230 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)234 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density497 mg/cm³

03Chemical composition20 compounds

Compounds documented for Tabernaemontana stapfiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Iboga type12

Corynanthe type6

Aspidosperma type $ Corynanthe type $ Strychnos type2

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,15S,17S)-17-ethyl-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene	present	LOTUS
Dihydrocondylocarpine	present	LOTUS
Gabunamine	present	LOTUS
Ibogamine	present	LOTUS
Ibogamine-18-carboxylic acid, 13-methoxy-, methyl ester	present	LOTUS
Methyl (12R,14S,15Z)-15-ethylidene-3,17-diazapentacyclo[12.3.1.02,10.04,9.012,17]octadeca-2(10),4,6,8-tetraene-13-carboxylate	present	LOTUS
methyl (1R,15S,17R,18R)-17-ethyl-7-[(1S,12R,14R,15E,18R)-15-ethylidene-18-methoxycarbonyl-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-yl]-6-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene-1-carboxylate	present	LOTUS
methyl (1R,3'S,12R,14S,15R,18S)-12-[(1R,15S,17R,18R)-17-ethyl-6-methoxy-1-methoxycarbonyl-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraen-7-yl]-3',17-dimethylspiro[10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraene-15,2'-oxirane]-18-carboxylate	present	LOTUS
methyl (1S,12R,13R,14S,15E)-15-ethylidene-3,17-diazapentacyclo[12.3.1.02,10.04,9.012,17]octadeca-2(10),4,6,8-tetraene-13-carboxylate	present	LOTUS
methyl (1S,14R,15E,18R)-15-ethylidene-12-oxo-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraene-18-carboxylate	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana stapfiana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON951106.1 ↗755 bpKenya · 2014

ACGT

ATTATACTCCTGAATACGAAACCAAAGATACGGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAG …

Tabernaemontana stapfiana voucher PE CPG28582 Z.D. Chen et al. 28582 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type399 records

Wild obs. + sensor38

Museum / vouchered103

Cultivated / captive258

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 10≤1 km 2>10 km 1

13 georeferenced · 25 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence103

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 258

258 georeferenced

Open the mapnot free-living258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	32
MeiseBGlocation not on record	19
Saint Louis, US	15
National Museums of Kenyalocation not on record	10
Fort Worth, US	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
Arusha, TZ	2
MAlocation not on record	1
University of Stellenboschlocation not on record	1
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	1

11 institutions · 88 of 103 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)