Tabernaemontana rupicola

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records330

Data sources10

Biological traits13

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Tabernaemontana rupicola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility330 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF330 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Tabernaemontana rupicola is a species of plant in the family Apocynaceae.Tabernaemontana rupicola at www.theplantlist.org. It is found in northern South America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max8 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation mean120 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Habitat GIFTFloresta de Igapó, Floresta de Várzea

Woodinesswoody

03Chemical composition15 compounds

Compounds documented for Tabernaemontana rupicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Piperidine alkaloids3

Amarylidaceae alkaloids $ Iboga type2

Dibenzylbutyrolactone lignans2

Iboga type2

Arylnaphthalene and aryltetralin lignans $ Dibenzylbutane lignans1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S)-2-(1,3-benzodioxol-5-ylmethyl)-3-[(7-methoxy-1,3-benzodioxol-5-yl)methyl]butane-1,4-diol	present	NPASS
(2S,3S)-2-(5-Methoxy-3,4-methylenedioxybenzyl)-3-(3,4-methylenedioxybenzyl) butyrolactone	present	NPASS
(2S,3S,4S)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(7-methoxy-1,3-benzodioxol-5-yl)methyl]oxolan-2-ol	present	NPASS
8-trans-Piperamide-C-9-1	present	NPASS
methyl (1'S,2R,7'R,8'R,9'R)-9'-[(1S)-1-hydroxyethyl]-5-methoxy-3-oxospiro[1H-indole-2,6'-3-azatricyclo[5.3.1.03,8]undecane]-7'-carboxylate	present	LOTUS
methyl (1'S,2R,7'R,8'R,9'R)-9'-ethyl-5-methoxy-3-oxospiro[1H-indole-2,6'-3-azatricyclo[5.3.1.03,8]undecane]-7'-carboxylate	present	LOTUS
Montanine (C22 alkaloid)	present	LOTUS
N-[10-(13,14-Methylenedioxyphenyl)-7(E),9(Z)-pentadienoyl]-pyrrolidine	present	NPASS
Piperoleine	present	NPASS
Pyrrolidine, 1-(1-oxo-2,4-eicosadienyl)-, (E,E)-	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana rupicola has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKGU973961.1 ↗1 523 bpGuyana

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATG …

Tabernaemontana rupicola maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type330 records

Wild obs. + sensor15

Museum / vouchered315

Origin

Native15

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 2≤10 km 4>10 km 4

10 georeferenced · 5 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 5>10 km 1

7 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	123
Chicago, US	20
Kew, GB	17
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	16
University of Stellenboschlocation not on record	16
Saint Louis, US	15
Museum of Zoologylocation not on record	9
JBRJlocation not on record	9
Museu Paraense Emílio Goeldilocation not on record	9
Universidade Paulistalocation not on record	8
UNICAMPlocation not on record	7
South Kensington, GB	4
Anton de Kom University of Surinamelocation not on record	3
Wlocation not on record	3
San José, CR	3
Tampa, US	2
Laboratorio de Ictiologialocation not on record	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
ACT-Slocation not on record	2
Zlocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
Madison, US	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
USP-IBlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Paris, FR	1
UFPRlocation not on record	1
Elocation not on record	1
Tuscaloosa, US	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Santarém, BR	1
UFERSAlocation not on record	1

33 institutions · 287 of 315 vouchered records shown · 27 without an institution code

09Environmental DNA1 detections

Where the DNA of Tabernaemontana rupicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter1.90 °C

Max temp (day)29.6 °C

Min temp (night)22.6 °C

Precipitation186 mm/mo

Air humidity66.6 %

Moisture balance52.1 mm/mo

Vapour deficit1,106 Pa

Wind speed1.30 m/s

Cloud cover31.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)