Tabernaemontana pandacaqui

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records4 098

Data sources12

Biological traits44

DNA specimens13

eDNA detections9

Sources12 archives

Databases and archives Tabernaemontana pandacaqui's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 098 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS62 compounds

Occurrence & distributionGBIF4 098 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tabernaemontana pandacaqui, known as windmill bush and banana bush, is a species of plant in the dogbane family Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length20 mm

Fruit width9 mm

Leaf length50 mm

Leaf length max180 mm

Leaf length min50 mm

Leaf mass57.11 mg

Leaf mass per area35.46 g/m2

Leaf size1 668 mm²

⚠ sources differ — TRY: 1 668 mm² · AusTraits: 1 853 mm²

Leaf width28.05 mm

Leaf width max50 mm

Leaf width min20 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 3.5 m

Plant height max5 m

Plant height min1 m

Seed length5 mm

Seed mass27.51 mg

⚠ sources differ — TRY: 27.51 mg · AusTraits: 31.43 mg

Seed width4 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyynnnnnnnyy

Life formshrub

Life spanperennial

Pollination syndromebutterfly

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Habitat GIFTrain forest

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate obtriangular

Succulenceno

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)19.24 mm²/mg

Wood density585 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition62 compounds

Compounds documented for Tabernaemontana pandacaqui across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iboga type34

Corynanthe type16

Aspidosperma type5

Aspidosperma type $ Corynanthe type $ Strychnos type4

Unsaturated fatty acids1

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Coronaridine	present	LOTUS
(-)-Dregamine	present	LOTUS
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(1R,15S)-17-ethyl-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraene	present	LOTUS
(1R,15S,17S,18S)-17-ethyl-6-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraene	present	LOTUS
(1S)-1-[(1R,15R,17R,18R)-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraen-17-yl]ethanol	present	LOTUS
(1S)-1-[(1R,15R,17R,18R)-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraen-17-yl]ethanol	present	LOTUS
10-Methoxyibogamine	present	LOTUS
14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
19,20-Dehydroervatamine	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana pandacaqui has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences10

eDNA detections9

Countries5

The DNA barcodea real sequence read deposited for this species

rbcLLN883886.1 ↗540 bp

ACGT

TTGACTTATTATACTCCTGAATACAAACCAAAGGATACGGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGAA …

Tabernaemontana pandacaqui chloroplast partial rbcL gene intron, specimen voucher USTH 011260, isolate 12A-053

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Tabernaemontana pandacaqui carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 098 records

Wild obs. + sensor2 612

Museum / vouchered1 086

Cultivated / captive4

Fossil1

Other395

Origin

Native102

Introduced1

Range

Area of Occupancy AOO8 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 2 074≤1 km 182≤10 km 64>10 km 43

2 363 georeferenced · 249 without coordinates

Open the mapobservation + sensor2 612

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 98≤1 km 52≤10 km 217>10 km 117

484 georeferenced · 602 without coordinates

Open the institutions mapphysical evidence1 086

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	182
Museo Entomologico de Leonlocation not on record	118
Mount Annan, AU	101
Smithfield, AU	73
Canberra, AU	29
Fort Worth, US	20
Armidale, AU	17
Palmerston, AU	6
Wlocation not on record	5
Chicago, US	4
Chaguaramas, TT	3
Auckland, NZ	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Adelaide, AU	3
Taipei, TW	3
MeiseBGlocation not on record	3
James Cook Townsvillelocation not on record	3
Bronx, US	2
Zürich, CH	2
Cambridge University Herbariumlocation not on record	2
Xiamen, CN	2
Taipei, TW	2
MAlocation not on record	2
South Kensington, GB	2
Ypsilanti, US	1
John T. Waterhouse Herbariumlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Guangzhou, CN	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Columbia, US	1
Gump Stationlocation not on record	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
UEMAlocation not on record	1
University of the Sunshine Coastlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
Miami, US	1

36 institutions · 602 of 1 086 vouchered records shown · 479 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Tabernaemontana pandacaqui was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 15.8–25.8

Seasonal swing summer↔winter5.50 °C

Max temp (day)27.3 °C 20.1–27.8

Min temp (night)22.5 °C 12.1–25.0

Precipitation170 mm/mo 56.3–255

Air humidity63.2 % 55.7–66.4

Vapour deficit1,132 Pa 722–1,417

Cloud cover46.8 % 23.4–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabernaemontana pandacaqui

At a glance

Sources12 archives

Size & morphology17

Life cycle & reproduction9

Diet & foraging1

Habitat & environment12

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds62 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 098 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 098 records