Tabernaemontana pachysiphon

Stapf · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records421

Data sources14

Biological traits18

DNA specimens2

eDNA detections2

Sources14 archives

Databases and archives Tabernaemontana pachysiphon's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS85 compounds

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tabernaemontana pachysiphon grows as a shrub or small tree up to 15 m tall, with a trunk diameter of up to 40 cm. Its fragrant flowers feature white to pale yellow corolla lobes. The fruit is green, almost spherical, up to 15 cm in diameter. Its habitat is forests from sea level to 2200 m altitude. Its numerous local medicinal uses include as a styptic, and as a treatment for headache, hypertension and to relieve cramps. The species is native to tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height9 m

⚠ sources differ — GIFT: 9 m · TRY: 10 m

Plant height max9.75 m

Plant height min2.74 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTmoist forest and forest margins, riverine and gallery forest

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density523 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition85 compounds

Compounds documented for Tabernaemontana pachysiphon across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iboga type29

Corynanthe type26

Aspidosperma type24

Aspidosperma type $ Corynanthe type $ Strychnos type5

Aspidosperma type $ Aspidosperma-Iboga hybrid type (Vinca alkaloids)2

Documented compounds85 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Tubotaiwine	present	LOTUS
(+)-Vinblastine	present	NPASS
(-)-Coronaridine	present	LOTUS
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(1R,10R,15R,17S,18S)-17-ethyl-6,7-dimethoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2,4,6,8-tetraene	present	LOTUS
(1S,14R,15E,18R)-15-ethylidene-18-(hydroxymethyl)-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-one	present	LOTUS
(1S,14R,15Z,18R)-15-ethylidene-18-(hydroxymethyl)-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-one	present	LOTUS
(5alpha,12R,19alpha)-2,3-Didehydro-6alpha,7alpha-epoxyaspidospermidine-3-carboxylic acid methyl ester	present	LOTUS
(E)-16-Epi-normacusine B	present	LOTUS
10-Methoxycoronaridine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana pachysiphon has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLDQ660673.1 ↗1 292 bpBrazil

ACGT

TACGGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTAC …

Tabernaemontana pachysiphon ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tabernaemontana pachysiphon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, L. S. & A. O. Obembe. 1991. Chromosome studies in some trees and shrubs from S Nigeria. Willdenowia 21: 233–238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type421 records

Wild obs. + sensor185

Museum / vouchered226

Other10

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 18≤1 km 2≤10 km 5>10 km 1

26 georeferenced · 159 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	39
MeiseBGlocation not on record	18
Kew, GB	14
Université du Lomélocation not on record	10
HNBlocation not on record	9
Fort Worth, US	7
Leiden University Medical Centerlocation not on record	4
Stockholm, SE	4
Yaoundé, CM	3
Bronx, US	3
Arusha, TZ	2
Chongqing Museumlocation not on record	2
LSFlocation not on record	2
Forest Herbarium Ibadan (FHI)location not on record	2
TAFORI-LSRClocation not on record	2
Berlin, DE	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1
Philadelphia, US	1
Instituto de Investigação Científica Tropicallocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Frankfurt am Main	1
Uppsala, SE	1
National Herbarium of São Tomé and Principelocation not on record	1
DSMlocation not on record	1
South Kensington, GB	1
Istituto Agrario Castelnuovolocation not on record	1

29 institutions · 135 of 226 vouchered records shown · 89 without an institution code

09Environmental DNA2 detections

Where the DNA of Tabernaemontana pachysiphon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)