Tabernaemontana crassa

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records1 017

Data sources13

Biological traits20

DNA specimens12

eDNA detections5

Sources13 archives

Databases and archives Tabernaemontana crassa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 017 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS37 compounds

Occurrence & distributionGBIF1 017 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tabernaemontana crassa is a plant in the dogbane family Apocynaceae, native to tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height12.5 m

Seed mass179 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio12.02 g/g

Leaf c432 mg/g

Leaf dry-matter content (LDMC)161 mg/g

Leaf n36.12 mg/g

Leaf p2.21 mg/g

Nitrogen fixingnon_nitrogen_fixer

Wood density550 mg/cm³

03Chemical composition37 compounds

Compounds documented for Tabernaemontana crassa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Iboga type27

Corynanthe type8

Aspidosperma type2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-20S-Heyneanine	present	LOTUS
(-)-Coronaridine	present	LOTUS
(5alpha,12R,19alpha)-2,3-Didehydro-6alpha,7alpha-epoxyaspidospermidine-3-carboxylic acid methyl ester	present	LOTUS
10-Methoxyibogamine	present	LOTUS
19(S)-Hydroxyconopharyngine	present	LOTUS
2H-2,7a-Methanoindolo[2,3-a]quinolizine-13-carboxylic acid, 13-[(acetyloxy)methyl]-3-ethylidene-1,3,4,6,7,12b-hexahydro-, methyl ester, (2S,3E,5S,7aS,12bS,13R)-	present	LOTUS
Akuammiline	present	LOTUS
Conopharyngine	present	LOTUS
Coronaridine	present	LOTUS
Coronaridine Hydroxyindolenine	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana crassa has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences8

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN723985.1 ↗356 bpCameroon

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Tabernaemontana crassa voucher TabCra_11-19 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Tabernaemontana crassa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1959

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

CCDB · book-fedorov — Mangenot S., Mange-- not G. 1958, 1962

CCDB · Cave1959 — Mang. & Mang. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 017 records

Wild obs. + sensor209

Museum / vouchered808

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 3

6 georeferenced · 203 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 4≤10 km 4>10 km 1

10 georeferenced · 798 without coordinates

Open the institutions mapphysical evidence808

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	83
LBVlocation not on record	78
MeiseBGlocation not on record	72
BRLUlocation not on record	59
WAGlocation not on record	40
Herbier National du Gabonlocation not on record	33
Yaoundé, CM	32
Kew, GB	27
Plocation not on record	10
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
CNF-UFHBlocation not on record	7
National Herbarium of São Tomé and Principelocation not on record	6
University of Santo Tomas Museumlocation not on record	6
MAlocation not on record	5
IPHAMETRAlocation not on record	5
Forest Herbarium Ibadan (FHI)location not on record	4
Stockholm, SE	4
Dresden, DE	4
Brussels, BE	4
Universite Libre de Bruxelleslocation not on record	3
Frankfurt am Main	3
Bronx, US	3
Philadelphia, US	3
Claremont, US	2
BMlocation not on record	2
University of Stellenboschlocation not on record	2
Edinburgh, GB	2
South Kensington, GB	2
Beijing, CN	1
Auckland, NZ	1
Denver, US	1
Coimbra, PT	1
St. Augustine, TT	1
Istituto Agrario Castelnuovolocation not on record	1
HNBlocation not on record	1
St. Paul, US	1
Llocation not on record	1
EFGlocation not on record	1
Chongqing Museumlocation not on record	1
CJBGlocation not on record	1
National Botanical Gardens of Belgiumlocation not on record	1

42 institutions · 529 of 808 vouchered records shown · 278 without an institution code

09Environmental DNA5 detections

Where the DNA of Tabernaemontana crassa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 15.7–24.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)27.7 °C 19.1–28.9

Min temp (night)21.8 °C 12.1–21.8

Precipitation405 mm/mo 54.8–405

Air humidity74.7 % 63.5–74.7

Moisture balance296 mm/mo -49.3–296

Vapour deficit763 Pa 597–972

Wind speed0.9 m/s 0.9–3.70

Cloud cover33.4 % 33.4–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabernaemontana crassa

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry7

Compound class profile3 classes

Documented compounds37 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 017 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 017 records