Tabernaemontana coffeoides

Bojer ex A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records1 339

Data sources10

Biological traits17

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Tabernaemontana coffeoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS74 compounds

Occurrence & distributionGBIF1 339 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Tabernaemontana coffeoides là một loài thực vật có hoa trong họ La bố ma. Loài này được Bojer ex A.DC. miêu tả khoa học đầu tiên năm 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height5 m

Seed mass56.94 mg

Seed mass max70.99 mg

Seed mass min42.89 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition74 compounds

Compounds documented for Tabernaemontana coffeoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Corynanthe type28

Iboga type12

Aspidosperma type10

Aspidosperma type $ Corynanthe type5

Flavones4

Documented compounds74 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-20S-Heyneanine	present	LOTUS
(-)-Coronaridine	present	LOTUS
(-)-Dregamine	present	LOTUS
(11S,12Z,17S)-12-ethylidene-6-hydroxy-8,14-diazapentacyclo[9.5.2.01,9.02,7.014,17]octadeca-2(7),3,5,9-tetraene-10-carbaldehyde	present	LOTUS
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(1Ar,3as,11as,12as,12bs,13ar,15as,23as,24as,24bs)-12a,24a-diethyl-1a,4,5,11a,12,12a,13a,14,15a,16,17,23,23a,24,24a,24b-hexadecahydro-2h,3ah,11h,12bh-22a,23b-epoxybisoxireno[6,7]indolizino[1,8-fg:1,8-f'g'][1,5]diazocino[3,2,1-jk:7,6,5-j'k']dicarbazole	present	LOTUS
(1R,11S,12E,17S)-12-ethylidene-6-hydroxy-8,14-diazapentacyclo[9.5.2.01,9.02,7.014,17]octadeca-2(7),3,5,9-tetraene-10-carbaldehyde	present	LOTUS
(1R,15S,17S)-17-ethyl-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene	present	LOTUS
(1R,9R,10S,12R,13E,16S)-13-ethylidene-8-methyl-8,15-diazahexacyclo[14.2.1.01,9.02,7.010,15.012,17]nonadeca-2,4,6-trien-18-ol	present	LOTUS
(1R,9R,10S,12R,13E,16S,18R)-13-ethylidene-8-methyl-8,15-diazahexacyclo[14.2.1.01,9.02,7.010,15.012,17]nonadeca-2,4,6-trien-18-ol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana coffeoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKGU973924.1 ↗1 535 bpMadagascar

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATG …

Tabernaemontana coffeoides maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type1 339 records

Wild obs. + sensor105

Museum / vouchered1 234

Origin

Native18

Range

Area of Occupancy AOO1 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 32≤10 km 27>10 km 3

62 georeferenced · 43 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 15≤1 km 15≤10 km 7>10 km 4

41 georeferenced · 1 193 without coordinates

Open the institutions mapphysical evidence1 234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	349
Saint Louis, US	184
Plocation not on record	158
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	114
Kew, GB	92
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	49
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	42
WAGlocation not on record	42
Glocation not on record	23
CJBGlocation not on record	23
University of Stellenboschlocation not on record	12
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	10
Stockholm, SE	8
MeiseBGlocation not on record	5
Frankfurt am Main	3
CASlocation not on record	2
MAlocation not on record	2
BMlocation not on record	2
Llocation not on record	2
Zlocation not on record	1
IPA/SPlocation not on record	1
Seychelles National Herbariumlocation not on record	1
Pretoria, ZA	1
Unknownlocation not on record	1
Uppsala, SE	1
South Kensington, GB	1
Fort Worth, US	1

27 institutions · 1 130 of 1 234 vouchered records shown · 102 without an institution code

09Environmental DNA1 detections

Where the DNA of Tabernaemontana coffeoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.4–18.4

Seasonal swing summer↔winter5.30 °C

Max temp (day)23.4 °C

Min temp (night)12.9 °C

Precipitation163 mm/mo

Air humidity58.7 %

Moisture balance34.0 mm/mo

Vapour deficit870 Pa

Wind speed2.80 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabernaemontana coffeoides

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds74 total

At a glance

Record type1 339 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 339 records