Tabernaemontana citrifolia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records446

Data sources9

Biological traits14

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Tabernaemontana citrifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility446 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS37 compounds

Occurrence & distributionGBIF446 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Tabernaemontana citrifolia est une espèce de plantes à fleurs la famille des Apocynacées. C'est un arbuste ou un petit arbre de 2 à 10 m de hauteur, connu aux Antilles françaises sous le nom de bois-lait.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height3 m

Seed mass23.1 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition37 compounds

Compounds documented for Tabernaemontana citrifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iboga type21

Corynanthe type6

Aspidosperma type5

Aspidosperma type $ Corynanthe type3

Aspidosperma type $ Corynanthe type $ Strychnos type2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Coronaridine	present	LOTUS
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(1R,15S,17S)-17-ethyl-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene	present	LOTUS
(1S)-1-[(1R,15R,17R,18R)-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraen-17-yl]ethanol	present	LOTUS
(1S)-1-[(1R,15S,17S,18R)-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraen-17-yl]ethanol	present	LOTUS
(5alpha,12R,19alpha)-2,3-Didehydro-6alpha,7alpha-epoxyaspidospermidine-3-carboxylic acid methyl ester	present	LOTUS
10-Methoxycoronaridine	present	LOTUS
10-Methoxyibogamine	present	LOTUS
14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
Akuammidine	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana citrifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKJ082604.1 ↗413 bpPuerto Rico · 2011

ACGT

GACTTATTATACTCCTGAATACGAAACCAAAGATACGGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGA …

Tabernaemontana citrifolia voucher 0118735327 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type446 records

Wild obs. + sensor95

Museum / vouchered350

Other1

Range

Area of Occupancy AOO1 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 31≤1 km 23≤10 km 15>10 km 12

81 georeferenced · 14 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 130≤1 km 3≤10 km 8>10 km 3

144 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence350

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	123
Bronx, US	42
Saint Louis, US	26
Mexico City, MX	18
University of Stellenboschlocation not on record	17
Chicago, US	15
Chapingo, MX	10
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	6
Tampa, US	5
Mexico City, MX	4
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	4
Austin, US	3
St. Paul, US	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	2
Stockholm, SE	2
Mexico City, MX	2
Miami, US	2
Kew, GB	2
NO DISPONIBLElocation not on record	2
Tuxtla Gutiérrez, MX	1
Toronto, CA	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
ASUlocation not on record	1
Wuzhou, CN	1
Uniwersytet Śląski w Katowicachlocation not on record	1
MeiseBGlocation not on record	1
Paris, FR	1
Madison, US	1

29 institutions · 299 of 350 vouchered records shown · 50 without an institution code

09Environmental DNA2 detections

Where the DNA of Tabernaemontana citrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.0 °C

Min temp (night)20.7 °C

Precipitation183 mm/mo

Air humidity66.7 %

Moisture balance23.4 mm/mo

Vapour deficit998 Pa

Wind speed2.00 m/s

Cloud cover27.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)