Tabernaemontana cerifera

Pancher & Sebert · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records145

Data sources8

Biological traits9

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Tabernaemontana cerifera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS16 compounds

Occurrence & distributionGBIF145 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Tabernaemontana cerifera is a species of plant in the family Apocynaceae. It is found in New Caledonia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition16 compounds

Compounds documented for Tabernaemontana cerifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Iboga type8

Corynanthe type5

Ergot alkaloids2

Carboline alkaloids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(1R,15S)-17-ethyl-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraene	present	LOTUS
10-Methoxycoronaridine	present	LOTUS
13-Ethyl-9-methoxy-1a,4,5,10,11,12,13,13a-octahydro-2h-3,13-methanooxireno[9,10]azacycloundecino[5,4-b]indole	present	LOTUS
14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
9H-Voacangine, 9-hydroxy-	present	LOTUS
Ibogaine	present	LOTUS
methyl (1S,12R,14S,15E,18S)-12-[3-(2-aminoethyl)-1H-indol-6-yl]-15-ethylidene-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraene-18-carboxylate	present	LOTUS
methyl (1S,12S,14R,15Z,18S)-12-[3-(2-aminoethyl)-1H-indol-6-yl]-15-ethylidene-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraene-18-carboxylate	present	LOTUS
Methyl 12-methoxyibogamine-18-carboxylate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana cerifera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKGU973921.1 ↗1 535 bpFrance

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATG …

Tabernaemontana cerifera maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor63

Museum / vouchered82

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 27≤1 km 8≤10 km 4>10 km 5

44 georeferenced · 19 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 6

7 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	57
Zürich, CH	4
MeiseBGlocation not on record	4
Moscow State Universitylocation not on record	3
Monastir, TN	3
Saint Louis, US	2
Institut de Recherche pour le Développement (IRD) Nouvelle Calédonielocation not on record	2
South Kensington, GB	1

8 institutions · 76 of 82 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Tabernaemontana cerifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–11.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C

Min temp (night)7.30 °C

Precipitation76.5 mm/mo

Air humidity62.5 %

Moisture balance-8.00 mm/mo

Vapour deficit552 Pa

Wind speed4.60 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)