Tabernaemontana arborea

Rose ex Donn.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records198

Data sources9

Biological traits37

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Tabernaemontana arborea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources37 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF198 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Tabernaemontana arborea is a species of plant in the family Apocynaceae.Tabernaemontana arborea at www.theplantlist.org. It is found in southern Mexico, Central America, and Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Leaf length115 mm

Leaf width58 mm

Plant height11 m

⚠ sources differ — GIFT: 11 m · TRY: 28.15 m

Plant height max28 m

Seed length11.2 mm

Seed length max30 mm

Seed length min15 mm

Seed mass429 mg

Seed mass max760 mg

Seed mass min97.8 mg

Seed width max4.8 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry10

Ldmc max290 mg/g

Ldmc min290 mg/g

Leaf C:N ratio15.43 g/g

Leaf c480 mg/g

Leaf dry-matter content (LDMC)233 mg/g

⚠ sources differ — TRY: 233 mg/g · GIFT: 290 mg/g

Leaf n31.45 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)28.36 mm²/mg

Wood density613 mg/cm³

Other traits2

Leaf thickness0.022 mm

Seed height max4.2 mm

03Chemical composition10 compounds

Compounds documented for Tabernaemontana arborea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iboga type9

Aspidosperma type1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,15S)-17-ethyl-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4(9),5,7-tetraene	present	LOTUS
10-Methoxycoronaridine	present	LOTUS
CID 199861	present	LOTUS
Epivoacorine	present	LOTUS
methyl (1R,15S,17R,18R)-6-[(1S,12R,14R,15Z,18R)-15-ethylidene-18-methoxycarbonyl-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-yl]-17-[(1R)-1-hydroxyethyl]-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene-1-carboxylate	present	LOTUS
Methyl 12-methoxy-13-(17-methoxy-17-oxovobasan-3alpha-yl)ibogamine-18-carboxylate	present	LOTUS
Methyl 12-methoxyibogamine-18-carboxylate	present	LOTUS
Methyl 13-methoxyibogamine-18-carboxylate	present	LOTUS
Tabersonine	present	LOTUS
Voacangine	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana arborea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX404691.1 ↗711 bpPanama · 2018

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCGAAGCAAACGACCCGCGAACTTGTTTCACTCCGGGCTTCGGTCGGGG …

Tabernaemontana arborea culture STRI:Corteva SJWright MP00356 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type198 records

Wild obs. + sensor16

Museum / vouchered182

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 2≤10 km 1

9 georeferenced · 7 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 62≤1 km 26≤10 km 12>10 km 5

105 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	46
Mexico City, MX	31
Museo Nacional de Costa Rica (MNCR)location not on record	21
Mexico City, MX	17
Austin, US	9
Universidad Juárez Autónoma de Tabascolocation not on record	7
Universidad de Antioquia (UdeA)location not on record	6
Mérida, MX	5
Tapachula, MX	5
Guatemala, GT	4
MAlocation not on record	3
Tuxtla Gutiérrez, MX	3
Mexico City, MX	2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	2
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	2
Madison, US	2
ASUlocation not on record	2
Mexico City, MX	2
Tuxtla Gutiérrez, MX	1
Davis, US	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
University of Zhejianglocation not on record	1
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	1
San Francisco, US	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Miami, US	1
Cambridge, US	1
Edinburgh, GB	1

28 institutions · 179 of 182 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Tabernaemontana arborea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 14.1–25.7

Seasonal swing summer↔winter5.70 °C

Max temp (day)22.5 °C 19.2–27.3

Min temp (night)18.2 °C 10.2–24.3

Precipitation79.6 mm/mo 74.3–310

Air humidity65.8 % 59.0–70.6

Moisture balance265 mm/mo

Vapour deficit733 Pa 688–1,127

Wind speed5.80 m/s

Cloud cover28.8 % 23.4–35.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)