Tabernaemontana africana

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Tabernaemontana

At a glance

Occurrence records193

Data sources9

Biological traits15

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Tabernaemontana africana's data was compiled from.

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF193 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height6 m

Plant height max7.62 m

Plant height min1.52 m

Seed mass75.51 mg

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition9 compounds

Compounds documented for Tabernaemontana africana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iboga type2

Amino cyclitols $ Aminoglycosides1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
CKIBPMQWYILJLC-QKAWTYPISA-N	present	NPASS
Conodurine	present	NPASS
GYWVPEGPVGUBPJ-RLTZHKMBSA-N	present	NPASS
JYGLLGJPSYLSDC-BLHNRARISA-N	present	NPASS
methyl (1S,15S,17S,18S)-7-[(1S,12S,14R)-15-ethenyl-18-methoxycarbonyl-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-yl]-17-ethyl-6-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene-1-carboxylate	present	NPASS
OIFIZUGEZGVEFS-ACLLEBEASA-N	present	NPASS
Streptomycin	present	NPASS
Voaphylline	present	LOTUS
XGCPCTTUHAFXHF-WPWMEVIPSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabernaemontana africana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

matKGU973911.1 ↗1 534 bpNetherlands

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATG …

Tabernaemontana africana maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tabernaemontana africana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1959

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

CCDB · book-fedorov — Mangenot S., Mangll' not G. 1958, 1962

CCDB · Cave1959 — Mang. & Mang. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type193 records

Wild obs. + sensor48

Museum / vouchered145

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 43 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 145 records without

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	14
Herbier National du Gabonlocation not on record	11
Kew, GB	10
WAGlocation not on record	10
Paris, FR	3
Stockholm, SE	3
NAlocation not on record	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
INMAlocation not on record	1
Plocation not on record	1
Université de Bordeauxlocation not on record	1
UnBlocation not on record	1
MAlocation not on record	1
Zürich, CH	1
Beijing, CN	1
Santa Teresa, BR	1
MeiseBGlocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Honolulu, US	1
Frankfurt am Main	1
Daubeny Herbarium, Oxfordlocation not on record	1

21 institutions · 68 of 145 vouchered records shown · 75 without an institution code

09Environmental DNA2 detections

Where the DNA of Tabernaemontana africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 11.4–22.5

Seasonal swing summer↔winter8.90 °C

Max temp (day)20.8 °C 14.9–26.7

Min temp (night)13.4 °C 8.00–18.8

Precipitation81.8 mm/mo 75.4–88.2

Air humidity66.6 % 64.3–68.8

Moisture balance-14.6 mm/mo -25.4–-3.80

Vapour deficit695 Pa 529–861

Wind speed3.00 m/s 1.40–4.70

Cloud cover34.5 % 26.9–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)