Tabebuia pallida

(Lindl.) Miers · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Tabebuia

At a glance

Occurrence records235

Data sources10

Biological traits14

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Tabebuia pallida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF235 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Tabebuia pallida is a species of Tabebuia native to the Caribbean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass10.31 mg

Life cycle & reproduction4

Deciduousnessvariable

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density580 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabebuia pallida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKX689349.1 ↗415 bp

ACGT

CTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCCCGCTCCACG …

Tabebuia pallida isolate TAPA3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tabebuia pallida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Simmonds, N.W. 1954 I

CCDB · book-fedorov — Simmonds 1954

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type235 records

Wild obs. + sensor139

Museum / vouchered96

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 41≤1 km 30≤10 km 20>10 km 19

110 georeferenced · 29 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	37
University of Stellenboschlocation not on record	7
Durban, ZA	6
Paris, FR	5
Honolulu, US	4
Bronx, US	3
Saint Louis, US	3
UFMSlocation not on record	2
BISHlocation not on record	2
CNF-UFHBlocation not on record	1
Seychelles National Herbariumlocation not on record	1
Burlington, US	1
Miami, US	1
ASUlocation not on record	1
Angwin, US	1
Toronto, CA	1
Bloomington, US	1

17 institutions · 77 of 96 vouchered records shown · 19 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)