Tabanus lineola

Fabricius, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records2 144

Data sources8

Biological traits0

DNA specimens14

eDNA detections3

Sources8 archives

Databases and archives Tabanus lineola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF2 144 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD14 specimens

01Narrative

Tabanus lineola, also known as the striped horse fly, is a species of biting horse-fly. It is known from the eastern and southern United States and the Gulf coast of Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus lineola has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes2

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

9Gmostly conserved

78Amostly conserved

168Gvariable

195Tmostly conserved

210Tmostly conserved

216Amostly conserved

225Tmostly conserved

253Tmostly conserved

258Tmostly conserved

261Gmostly conserved

300Tmostly conserved

303Gmostly conserved

309Amostly conserved

327Cmostly conserved

333Cmostly conserved

351Cmostly conserved

387Amostly conserved

411Tmostly conserved

474Tmostly conserved

487Tmostly conserved

520Cmostly conserved

531Cvariable

552Amostly conserved

576Tmostly conserved

603Tmostly conserved

618Amostly conserved

ATTTTTGGGGCATGAGCCGGAATAATTGGAACATCTTTAAGAATTCTAATTCGAGCTGAATTAGGACATCCTGGATCACTAATTGGTGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BINs2

Most divergent pair3.9%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus similissame genus2.3%Tabanus subsimilissame genus2.7%Tabanus occidentalissame genus5.2%Tabanus claripennissame genus5.3%Poeciloderas quadripunctatussame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type2 144 records

Wild obs. + sensor498

Museum / vouchered1 646

Range

Area of Occupancy AOO3 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 238≤1 km 63≤10 km 20>10 km 65

386 georeferenced · 112 without coordinates

Open the mapobservation + sensor498

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 17≤1 km 282≤10 km 807>10 km 67

1 173 georeferenced · 473 without coordinates

Open the institutions mapphysical evidence1 646

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	549
Mississippi State, US	319
CUlocation not on record	167
East Lansing, US	151
New Haven, US	115
Chicago, US	58
University of Guelphlocation not on record	54
Cleveland Museum of Natural History, OH (CLEV)location not on record	54
Lubbock, US	29
Cambridge, US	8
Lake Placid, US	8
Albuquerque, US	4
College Station, US	4
Vancouver, CA	3
Chicago, US	2
San Francisco, US	2
WIlocation not on record	1
California Academy of Scienceslocation not on record	1
Washington, US	1

19 institutions · 1 530 of 1 646 vouchered records shown · 116 without an institution code

09Environmental DNA3 detections

Where the DNA of Tabanus lineola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

Canopy

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabanus lineola

At a glance

Sources8 archives

At a glance

Record type2 144 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 144 records