Tabanus gratus

Loew, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records147

Data sources5

Biological traits0

DNA specimens55

eDNA detections58

Sources5 archives

Databases and archives Tabanus gratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF147 records

Environmental DNA1 datasets · 3 countries58 detections

DNA & barcodingBOLD55 specimens

01Narrative

Tabanus gratus (лат.) — вид слепней из подсемейства Tabaninae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus gratus has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections58

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

7Cmostly conserved

16Cmostly conserved

19Amostly conserved

22Amostly conserved

64Amostly conserved

76Gmostly conserved

82Tmostly conserved

86Gmostly conserved

103Tmostly conserved

139Cmostly conserved

184Cmostly conserved

214Gmostly conserved

217Amostly conserved

220Amostly conserved

238Tmostly conserved

268Cmostly conserved

274Tmostly conserved

310Cmostly conserved

319Gmostly conserved

361Tmostly conserved

367Tmostly conserved

370Amostly conserved

430Gmostly conserved

457Cmostly conserved

472Amostly conserved

565Amostly conserved

607Cmostly conserved

613Tmostly conserved

634Amostly conserved

637Cmostly conserved

638Tmostly conserved

643Cmostly conserved

645Amostly conserved

647Cmostly conserved

648Amostly conserved

649Tmostly conserved

652Amostly conserved

653Tmostly conserved

ATTATACTTTATTTTCGGAGCATGAGCCGGAATAATTGGAACTTCATTAAGTATTTTAATTCGAGCTGAATTAGGGCATCCTGGAGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes18

BINs3

Most divergent pair8.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hybomitra rhombicasame family7.4%Tabanus bifariussame genus7.6%Tabanus superjumentariussame genus7.7%Hybomitra epistatessame family7.8%Tabanus sparussame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type147 records

Wild obs. + sensor17

Museum / vouchered130

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 12≤1 km 2

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 1≤1 km 62≤10 km 13>10 km 1

77 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muséum d'histoire naturelle de Marseillelocation not on record	62
KwaZulu-Natal Museumlocation not on record	38
UNHClocation not on record	13
National Museums of Kenyalocation not on record	4
Durban Natural Science Museumlocation not on record	2
Cape Town, ZA	2
New Haven, US	1
Helsinki, FI	1
Instituto de Investigação Científica Tropicallocation not on record	1
Champaign, US	1

10 institutions · 125 of 130 vouchered records shown · 5 without an institution code

09Environmental DNA58 detections

Where the DNA of Tabanus gratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map3 countries0

Knob Thorn/MarulaÂ SavannahMopaneÂ ShrubveldAlluvial PlainsSabie/Crocodile Thorn Thicket2. Savanna | 2.1. Dry SavannaOlifantÂ Rugged Veld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 19.4–26.6

Seasonal swing summer↔winter9.10 °C

Max temp (day)28.4 °C 25.4–31.2

Min temp (night)15.9 °C 13.0–21.0

Precipitation15.3 mm/mo 4.50–90.5

Air humidity54.0 % 52.1–56.5

Moisture balance-85.0 mm/mo -116–-68.9

Vapour deficit1,240 Pa 987–1,539

Wind speed3.00 m/s 2.00–3.40

Cloud cover16.9 % 9.40–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)