Tabanus fulvulus

Wiedemann, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records772

Data sources7

Biological traits0

DNA specimens6

eDNA detections9

Sources7 archives

Databases and archives Tabanus fulvulus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF772 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

Tabanus fulvulus is a horse fly in the subfamily Tabaninae ("horse flies"), in the order Diptera ("flies").

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus fulvulus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes2

BINs3

Most divergent pair3.1%

Where individuals differ — all 41 variable positions, in barcode order

9Gmostly conserved

66Amostly conserved

72Tvariable

75Gvariable

120Gvariable

150Amostly conserved

153Amostly conserved

162Gvariable

174Tmostly conserved

198Gmostly conserved

199Tmostly conserved

207Tmostly conserved

216Amostly conserved

237Cvariable

258Tvariable

267Tvariable

327Cvariable

350Cvariable

360Amostly conserved

378Cmostly conserved

384Tvariable

387Tvariable

393Cvariable

394Tvariable

423Tvariable

444Amostly conserved

450Cvariable

462Tmostly conserved

465Amostly conserved

468Cvariable

477Cvariable

480Amostly conserved

487Cvariable

498Avariable

505Avariable

537Amostly conserved

544Tmostly conserved

567Tvariable

583Tmostly conserved

603Tmostly conserved

621Cvariable

ATTTTTGGGGCATGAGCCGGAATAATTGGTACTTCATTAAGTATTTTAATTCGAGCTGAATTAGGACATCCTGGGTCATTAATTGGTGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus pallidescenssame genus2.1%Tabanus longiusculussame genus5.3%Tabanus sackenisame genus5.5%Tabanus sublongussame genus5.6%Tabanus longussame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type772 records

Wild obs. + sensor89

Museum / vouchered683

Range

Area of Occupancy AOO868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 44≤1 km 16≤10 km 7>10 km 11

78 georeferenced · 11 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 6≤1 km 240≤10 km 271>10 km 7

524 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence683

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	391
Champaign, US	207
UNHClocation not on record	42
East Lansing, US	13
New Haven, US	7
Chicago, US	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Cornell University Insect Collectionlocation not on record	4
Albuquerque, US	2
University Park, US	2
Cambridge, US	1
CUlocation not on record	1
San Francisco, US	1

13 institutions · 683 of 683 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Tabanus fulvulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)31.2 °C

Min temp (night)21.5 °C

Precipitation116 mm/mo

Air humidity57.6 %

Moisture balance-66.8 mm/mo

Vapour deficit1,416 Pa

Wind speed2.50 m/s

Cloud cover30.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)