Tabanus bromius

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records6 551

Data sources9

Biological traits2

DNA specimens214

eDNA detections65

Sources9 archives

Databases and archives Tabanus bromius's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 551 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics214 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 551 records

Environmental DNA2 datasets · 5 countries65 detections

DNA & barcodingBOLD214 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Tabanus bromius, sometimes called the band-eyed brown horsefly, is a species of biting horseflies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)predator

05DNA & barcoding214 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus bromius has left across the world's sequence archives.

At a glance

DNA specimens214

BINs19

Marker genes2

eDNA detections65

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus206 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

16Tmostly conserved

22Amostly conserved

28Amostly conserved

46Cmostly conserved

79Tvariable

85Amostly conserved

88Amostly conserved

100Tvariable

133Cmostly conserved

145Cmostly conserved

157Cmostly conserved

211Avariable

217Amostly conserved

235Tvariable

238Cvariable

241Amostly conserved

263Tvariable

266Tmostly conserved

271Tvariable

274Avariable

316Gmostly conserved

322Avariable

328Amostly conserved

343Amostly conserved

346Amostly conserved

364Cvariable

367Tmostly conserved

373Amostly conserved

376Avariable

385Tvariable

400Amostly conserved

406Tmostly conserved

415Tvariable

416Amostly conserved

420Cmostly conserved

424Tmostly conserved

433Avariable

472Tmostly conserved

481Tmostly conserved

490Tmostly conserved

526Tmostly conserved

532Tmostly conserved

536Cmostly conserved

553Tmostly conserved

562Amostly conserved

581Tmostly conserved

582Tmostly conserved

583Amostly conserved

592Amostly conserved

628Amostly conserved

631Amostly conserved

634Cvariable

AACATTATATTTTATTTTTGGAGCATGAGCTGGAATAATTGGTACCTCATTAAGTATTTTAATTCGAGCTGAATTAGGTCATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 185 variants.

Diversity (π)2.8%

Haplotypes185

BINs19

Most divergent pair14.1%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus rupiumsame genus4.0%Tabanus mikisame genus4.4%Tabanus maculicornissame genus4.4%Tabanus tergestinussame genus5.0%Tabanus bifariussame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Tabanus bromius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 106×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Altunsoy, F. and A. Y. Kilic (2010). "Karyotype characterization of some Tabanidae (Diptera) species." Turkiye Entomoloji Dergisi-Turkish Journal Of Entomology 34(4): 477-494. ↗

08Occurrence & distribution

Record type6 551 records

Wild obs. + sensor5 294

Museum / vouchered1 254

Other3

Range

Area of Occupancy AOO11 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 2 027≤1 km 906≤10 km 1 991>10 km 6

4 930 georeferenced · 364 without coordinates

Open the mapobservation + sensor5 294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 273≤1 km 214≤10 km 454>10 km 9

950 georeferenced · 304 without coordinates

Open the institutions mapphysical evidence1 254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	493
Helsinki, FI	251
SLU Artdatabankenlocation not on record	84
Tilburg, NL	43
Instituto de Investigação Científica Tropicallocation not on record	38
University of Tokyo, Department of Zoologylocation not on record	37
NCMGlocation not on record	32
Gothenburg, SE	31
ZMAAlocation not on record	28
Kuopio, FI	20
Stockholm, SE	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	17
DFFW2016location not on record	14
CBDClocation not on record	9
neflocation not on record	8
NHMOlocation not on record	7
Tromsø, NO	6
BioFokuslocation not on record	5
Mississippi State, US	5
ZSMlocation not on record	4
Ataturk Universitylocation not on record	4
South Kensington, GB	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
DFFW1981location not on record	3
East Lansing, US	3
Banyoles, ES	2
Ugentlocation not on record	2
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Philadelphia, US	1
DFFW2018location not on record	1
Bavarian State Collection of Zoologylocation not on record	1
KwaZulu-Natal Museumlocation not on record	1

33 institutions · 1 178 of 1 254 vouchered records shown · 76 without an institution code

09Environmental DNA65 detections

Where the DNA of Tabanus bromius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 14.0–18.1

Seasonal swing summer↔winter19.1 °C

Max temp (day)19.2 °C 17.3–22.2

Min temp (night)12.2 °C 9.20–14.3

Precipitation70.1 mm/mo 60.1–171

Air humidity60.9 % 58.2–62.5

Moisture balance35.4 mm/mo

Vapour deficit706 Pa 619–828

Wind speed2.90 m/s

Cloud cover38.2 % 27.0–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabanus bromius

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 551 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 551 records