Tabanus autumnalis

Linnaeus, 1761 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records11 062

Data sources7

Biological traits2

DNA specimens15

eDNA detections37

Sources7 archives

Databases and archives Tabanus autumnalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 062 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF11 062 records

Environmental DNA3 datasets · 8 countries37 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceTreeOfSex2n = 14

01Narrative

Tabanus autumnalis, the large marsh horsefly, is a medium-sized species of biting horse-fly. It is somewhat scarce compared to T. bromius and T. bovinus. This species shows slightly more of a preference for coastal marsh than some of the other European Tabanus, sometime even found in saltmashes. Wing length is 13–16 mm and about 16–22 mm in body length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)predator

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus autumnalis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections37

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

60Amostly conserved

84Tmostly conserved

87Gvariable

165Amostly conserved

183Gmostly conserved

186Tmostly conserved

228Gmostly conserved

261Amostly conserved

270Tmostly conserved

273Gmostly conserved

363Tmostly conserved

465Gmostly conserved

642Gvariable

ACATTATATTTTATTTTTGGGGCATGAGCTGGAATAATTGGTACTTCATTAAGTATCTTAATTCGAGCTGAATTAGGTCATCCTGGGTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes5

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus vivaxsame genus5.2%Tabanus nigripessame genus5.3%Tabanus marginalissame genus5.3%Tabanus striatussame genus5.6%Tabanus nipponicussame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Tabanus autumnalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×TreeOfSex · invert

TreeOfSex · invert — Altunsoy, F. and A. Y. Kilic (2010). "Karyotype characterization of some Tabanidae (Diptera) species." Turkiye Entomoloji Dergisi-Turkish Journal Of Entomology 34(4): 477-494. ↗

08Occurrence & distribution

Record type11 062 records

Wild obs. + sensor10 891

Museum / vouchered170

Other1

Origin

Native1

Range

Area of Occupancy AOO11 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 1 081≤1 km 510≤10 km 7 646>10 km 11

9 248 georeferenced · 1 643 without coordinates

Open the mapobservation + sensor10 891

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 13≤1 km 44≤10 km 89>10 km 3

149 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	32
SLU Artdatabankenlocation not on record	28
Instituto de Investigação Científica Tropicallocation not on record	22
Museu Nacional de História Natural e da Ciêncialocation not on record	22
Tilburg, NL	19
Mississippi State, US	5
CBDClocation not on record	4
Helsinki, FI	4
NCMGlocation not on record	4
ZSMlocation not on record	3
Gothenburg, SE	3
South Kensington, GB	3
Stockholm, SE	2
SGAV-and-NHMDlocation not on record	2
Chicago, US	2
Natural History Museum Rotterdamlocation not on record	2
Ugentlocation not on record	2
DFlocation not on record	1
BioFokuslocation not on record	1
DFFW2016location not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Museum of National History ISLAMABAD, PAKISTANlocation not on record	1

22 institutions · 164 of 170 vouchered records shown · 6 without an institution code

09Environmental DNA37 detections

Where the DNA of Tabanus autumnalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys3

Countries8

Verifiable raw sequence linked20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 14.5–19.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)20.2 °C 17.5–22.3

Min temp (night)13.6 °C 10.9–15.0

Precipitation67.8 mm/mo 26.4–78.6

Air humidity61.3 % 56.2–62.4

Moisture balance-38.4 mm/mo -84.6–-24.4

Vapour deficit724 Pa 636–973

Wind speed4.20 m/s 3.40–4.60

Cloud cover41.6 % 37.0–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabanus autumnalis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 062 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 062 records