Syzygium xerampelinum

B.Hyland · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Syzygium

At a glance

Occurrence records179

Data sources7

Biological traits27

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Syzygium xerampelinum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF179 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Syzygium xerampelinum, known as the Mulgrave satinash, is a rare rainforest tree of tropical Queensland, Australia. The bark and fruit are similar to the often cultivated magenta cherry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length16.5 mm

Fruit width14.5 mm

Leaf length100 mm

Leaf width42.5 mm

Plant height17 m

Seed length11 mm

Seed mass551 mg

Seed mass max551 mg

Seed mass min551 mg

Seed width11.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnyyyyyyn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syzygium xerampelinum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY187220.2 ↗599 bp

ACGT

TCGAATCCTGCCCAGCAGAACGACCAGAGAACCAGTAACAAACTCAATGGGGACGGTGGGCCTCGCCCAACGTCTCCGGACGCTTGGATG …

Syzygium xerampelinum internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type179 records

Wild obs. + sensor10

Museum / vouchered168

Other1

Origin

Native10

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 2≤10 km 6

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 6≤1 km 12≤10 km 68>10 km 6

92 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	90
Brisbane, AU	21
Canberra, AU	16
Mount Annan, AU	9
Museo Entomologico de Leonlocation not on record	7
Kew, GB	4
Palmerston, AU	4
Paris, FR	1
Claremont, US	1
James Cook Townsvillelocation not on record	1
Honolulu, US	1
Saint Louis, US	1

12 institutions · 156 of 168 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Syzygium xerampelinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)