Syzygium sandwicense

(A.Gray) Nied. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Syzygium

At a glance

Occurrence records241

Data sources12

Biological traits28

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Syzygium sandwicense's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS20 compounds

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GIFT2n = 22

01Narrative

Syzygium sandwicense is a species of flowering plant in the myrtle family, Myrtaceae, that is endemic to Hawaii. Common names include Ōhia ha, Hā, and Pāihi. It is normally a large tree, reaching a height of 18 m and a trunk diameter of 0.9 m, but is a shrub on exposed ridges. Ōhia ha inhabits coastal mesic forests, mixed mesic forests, wet forests, and bogs at elevations of 230 – on most main islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length max10 mm

Fruit length min4 mm

Leaf length max140 mm

Leaf length min20 mm

Leaf width max50 mm

Leaf width min15 mm

Plant height max25 m

Plant height min3 m

Seed width max5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscenceindehiscent

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio40.96 g/g

Leaf c512 mg/g

Leaf n12.5 mg/g

Leaf p0.66 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.78 mm²/mg

03Chemical composition20 compounds

Compounds documented for Syzygium sandwicense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids9

Lupane triterpenoids6

Stigmastane steroids3

Gallotannins $ Simple phenolic acids1

Cinnamic acids and derivatives $ Simple phenolic acids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aS,5aS,5bR,9R,10R,11aR)-9,10-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13b-tetradecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bR)-10,11-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-[[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxymethyl]-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,9R,10R,11R,12aR,14bS)-11-hydroxy-9-(hydroxymethyl)-10-[(Z)-3-(4-hydroxyphenyl)prop-2-enoyl]oxy-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
23-Hydroxybetulinic acid	present	LOTUS
2alpha,3alpha-Dihydroxylup-20(29)-en-28-oic acid	present	LOTUS
3-O-Coumaroylarjunolic acid	present	LOTUS
4-Hydroxy-3,5-dimethoxybenzaldehyde	present	LOTUS
Alphitolic Acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syzygium sandwicense has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKDQ088606.1 ↗1 529 bp

ACGT

GGGGTCAAATCAAATTTCCAATGGAGGAATTTAAAGGATATTTCGAACTAGATAGATCTCGACAACATGACTTCCTATACCCACTTCTTT …

Syzygium sandwicense maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Syzygium sandwicense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×GIFT · GIFT (floras)

GIFT · GIFT (floras)

n 111×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Carr 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type241 records

Wild obs. + sensor230

Museum / vouchered8

Other3

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 80≤1 km 9≤10 km 3>10 km 98

190 georeferenced · 40 without coordinates

Open the mapobservation + sensor230

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	4
Claremont, US	2
Vancouver, CA	1
Bronx, US	1

4 institutions · 8 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Syzygium sandwicense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)