Syzygium grande

(Wight) N.P.Balakr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Syzygium

At a glance

Occurrence records96

Data sources13

Biological traits36

DNA specimens0

eDNA detections1

Sources13 archives

Databases and archives Syzygium grande's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI≈405 Mbp

01Narrative

Syzygium firmum is a species of plant in the family Myrtaceae. It is endemic to Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Inflorescence length max7.0 cm

Inflorescence length min6 cm

Leaf length156 mm

Leaf length max170 mm

Leaf length min110 mm

Leaf width87 mm

Leaf width max60 mm

Leaf width min40 mm

Plant height22.17 m

⚠ sources differ — GIFT: 22.17 m · TRY: 10 m

Plant height max30 m

Plant height min3 m

Seed length21.2 mm

Seed mass1 859 mg

Seed mass max5 556 mg

Seed mass min1.9 mg

Seed width max17.2 mm

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza type0.00000848

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.4 mm²/mg

Wood density781 mg/cm³

Other traits2

Leaf thickness0.037 mm

Seed height max17 mm

03Chemical composition34 compounds

Compounds documented for Syzygium grande across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iridoids monoterpenoids12

Gallotannins8

Lupane triterpenoids3

Flavonols3

Friedelane triterpenoids2

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3aS,5aS,5bR,7aR,9R,10R,11aR,11bR,13bR)-9,10-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-propan-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13b-tetradecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1S,3aS,5aS,5bR,7aR,9S,11aR,11bR,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-propan-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13b-tetradecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1S,4aR,7S,7aR)-4a,7-dihydroxy-7-methyl-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4-carbaldehyde	present	NPASS
(1S,4aR,7S,7aS)-4a,7-dihydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4-carbaldehyde	present	NPASS
(1S,4aS,7R,7aS)-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carbaldehyde	present	NPASS
(1S,4aS,7S,7aR)-7-hydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carbaldehyde	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(1S,4aS,5S,7aR)-5-hydroxy-7-(hydroxymethyl)-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
1-Epi-castalagin	present	LOTUS
3-Methylellagic acid	present	LOTUS
8-Epiloganin	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syzygium grande has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW854167.1 ↗640 bp

ACGT

AGCAGAATGACCAGAGAACCAGTAACAAACTCAATGGAGACGGTGGGCCTCGCCCAACGTCTCTAGACGCTTGGATGGCACGGGCGCCTA …

Syzygium grande voucher KR0903 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Syzygium grande carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈405 179 882 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Syzygium grande0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Khosla, P.K. 1969, 1972

n 112×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · book-ipcn67-71 — MEHRA, P.N., & P.K. KHOSLA. 1969. In IOPB chromosome number reports XX. Taxon 18: 213-221.

CCDB · book-ipcn75-78 — Mehra 1976

n 161×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — MEHRA, P.N., & P.K. KHOSLA. 1972. Cytogenetical studies of East Himalayan Hamamelidaceae, Combretaceae and Myrtaceae. Silvae Genet. 21: 186-190.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type96 records

Wild obs. + sensor66

Museum / vouchered28

Other2

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 15≤1 km 1>10 km 48

64 georeferenced · 2 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 8≤10 km 1

9 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	8
St. Augustine, TT	5
Moscow State Universitylocation not on record	2
Parnell, J. (TCD), 1997.location not on record	1
National Institute of Biological Resourceslocation not on record	1

5 institutions · 17 of 28 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Syzygium grande was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)