Syzygium cordatum

Hochst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Syzygium

At a glance

Occurrence records2 738

Data sources7

Biological traits32

DNA specimens12

eDNA detections8

Sources7 archives

Databases and archives Syzygium cordatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 738 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources32 traits

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF2 738 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI12 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 17.5 m

Plant height max15 m

Plant height min3 m

Seed mass2 222 mg

Seed mass max2 222 mg

Seed mass min2 222 mg

Seed volume59 mm³

Seed volume max59 mm³

Seed volume min59 mm³

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 300 m

Elevation min5 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density620 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Syzygium cordatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins $ Simple phenolic acids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Gallic acid		present	NPASS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syzygium cordatum has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences8

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEF026625.1 ↗607 bp

ACGT

TCGAATCCTGCCTAGCAGAATGACCAGAGAACCAGTAACAAACTCAATGGGGACGGTGGGCCTCGCCCAACGTCTCTAGACGCTTGGATG …

Syzygium cordatum internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★trnL★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 738 records

Wild obs. + sensor2 420

Museum / vouchered318

Origin

Native346

Range

Area of Occupancy AOO5 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 682≤1 km 170≤10 km 65>10 km 12

1 929 georeferenced · 491 without coordinates

Open the mapobservation + sensor2 420

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1>10 km 2

3 georeferenced · 315 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	57
Saint Louis, US	43
MeiseBGlocation not on record	42
TAFORI-LSRClocation not on record	26
Pretoria, ZA	14
Instituto de Investigação Científica Tropicallocation not on record	13
Adam Mickiewicz University in Poznańlocation not on record	12
DSMlocation not on record	11
Bronx, US	4
University of Johannesburglocation not on record	2
Philadelphia, US	2
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
Uppsala, SE	1
Pittsburg, US	1
Berlin, DE	1
Llocation not on record	1
Kew, GB	1
Dekalb, US	1
Claremont, US	1
Chongqing Museumlocation not on record	1

20 institutions · 236 of 318 vouchered records shown · 82 without an institution code

09Environmental DNA8 detections

Where the DNA of Syzygium cordatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 18.3–20.7

Seasonal swing summer↔winter9.10 °C

Max temp (day)25.5 °C 24.7–25.9

Min temp (night)13.2 °C 11.3–15.3

Precipitation14.5 mm/mo 12.6–43.9

Air humidity55.2 % 50.3–57.4

Moisture balance-72.2 mm/mo -98.8–-58.4

Vapour deficit1,051 Pa 962–1,084

Wind speed2.30 m/s 1.90–2.60

Cloud cover15.9 % 9.80–23.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Syzygium cordatum

At a glance

Sources7 archives

Size & morphology9

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Record type2 738 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 738 records