Syngnathus leptorhynchus

Girard, 1854 · species

image placeholder — illustration coming later

Animalia/Chordata/Syngnathiformes/Syngnathidae/Syngnathus

At a glance

Occurrence records660

Data sources11

Biological traits8

DNA specimens19

eDNA detections99

Sources11 archives

Databases and archives Syngnathus leptorhynchus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility660 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF660 records

Environmental DNA3 datasets · 1 countries99 detections

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT · NCBI≈401 Mbp

01Narrative

The bay pipefish (Syngnathus leptorhynchus) is a pipefish native to the eelgrass beds of the Eastern Pacific (Southern Baja California to Gulf of Alaska),"Syngnathus leptorhynchus, Bay pipefish : aquarium." Web. 10 Dec 2009. http://www.fishbase.org/Summary/SpeciesSummary.php?id=3303 where its sinuous shape and green color allow it to blend in with the waving blades of eelgrass. Like other members of the seahorse family, male pipefish tend the eggs laid by their female partners in specialized pouches."Splendor in the Grass — Bay Nature Institute." Web. 10 Dec 2009. http://baynature.org/articles/apr-jun-2009/splendor-in-the-grassLamb, A, and Edgell, P. 2010. Coastal Fishes of the Pacific Northwest. British Columbia: Harbour Publishing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length32.5 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max5 m

Depth min0 m

Vulnerability28.5

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syngnathus leptorhynchus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes2

eDNA detections99

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

3Tmostly conserved

8Cvariable

184Cmostly conserved

412Avariable

493Gmostly conserved

565Tvariable

568Cmostly conserved

628Amostly conserved

CCTATATCTAGTATTTGGTGCATGAGCCGGAATGGTGGGTACTGCACTTAGCCTTCTCATCCGAGCAGAACTAAGTCAACCAGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Syngnathus auliscussame genus6.3%Syngnathus schmidtisame genus15.0%Syngnathus rostellatussame genus15.2%Syngnathus schlegelisame genus15.4%Syngnathus floridaesame genus16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_063777 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Syngnathus leptorhynchus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈400 874 984 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Syngnathus leptorhynchus0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~15.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin15.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Motilityactively mobile

Compositionhydroxyapatite

08Occurrence & distribution

Record type660 records

Wild obs. + sensor120

Museum / vouchered534

Other6

Origin

Native44

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 36≤1 km 3

39 georeferenced · 81 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 26≤1 km 48≤10 km 30>10 km 10

114 georeferenced · 420 without coordinates

Open the institutions mapphysical evidence534

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of California San Diegolocation not on record	145
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	51
Moore Laboratory of Zoology, Occidental Collegelocation not on record	41
CASlocation not on record	36
Los Angeles, US	26
Washington, US	25
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	19
UWFClocation not on record	16
Edmonton, CA	8
University of Alberta Museumslocation not on record	7
Vancouver, CA	7
University of Victorialocation not on record	6
Cambridge, US	5
Ann Arbor, US	5
Facultad de Ciencias Marinas, Universidad Autónoma de Baja Californialocation not on record	5
Toronto, CA	4
Chicago, US	4
North Carolina Museum of Natural Scienceslocation not on record	3
New Haven, US	3
Mexico City, MX	2
FishBaselocation not on record	2
Champaign, US	2
Stockholm, SE	1
Berkeley, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	1
University of Alabamalocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1
Paris, FR	1
Oregon State Universitylocation not on record	1

31 institutions · 431 of 534 vouchered records shown · 102 without an institution code

09Environmental DNA99 detections

Where the DNA of Syngnathus leptorhynchus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys3

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 14.1–18.5

Seasonal swing summer↔winter13.3 °C

Max temp (day)17.8 °C 16.6–23.5

Min temp (night)13.9 °C 12.8–15.1

Precipitation45.7 mm/mo 29.0–48.1

Air humidity61.3 % 59.9–62.4

Moisture balance-53.8 mm/mo

Vapour deficit681 Pa 621–855

Wind speed4.50 m/s

Cloud cover40.9 % 31.8–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)