Synandra hispidula

(Michx.) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Synandra

At a glance

Occurrence records678

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Synandra hispidula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility678 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF678 records

DNA & barcodingNCBIsequences

01Narrative

Synandra is a monotypic genusCantino, P. D. (1985). Facultative autogamy in Synandra hispidula (Labiatae). Castanea 50(2) 105-11. of flowering plants in the mint family containing the single species Synandra hispidula, which is known by the common name Guyandotte beauty. It is native to the east-central United States where it ranges from southern Illinois to western North Carolina and Virginia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formannual or biennial

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Synandra hispidula has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

matKHQ911426.1 ↗408 bp

ACGT

TTCTTTTGTCGGAAAATCTGGGTTATGACAATAAATCAAGTTTACTGATTGTGAAACGGTTAATTACTCGACTGTATCAAGAGAATCATT …

UNVERIFIED: Synandra hispidula isolate 104 maturase-like (matK) gene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

08Occurrence & distribution

Record type678 records

Wild obs. + sensor634

Museum / vouchered44

Range

Area of Occupancy AOO1 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 283≤1 km 85≤10 km 42>10 km 122

532 georeferenced · 102 without coordinates

Open the mapobservation + sensor634

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 6≤1 km 10≤10 km 18>10 km 1

35 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	14
Chongqing Museumlocation not on record	4
Columbia, US	3
Blacksburg, US	3
Jena Microbial Resource Collectionlocation not on record	2
Wuzhou, CN	2
Williamsburg, US	2
Bloomington, US	2
Fairfax, US	2
Tampa, US	1
Tennessee Technological Universitylocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Valdosta State Universitylocation not on record	1
Jackson, US	1
Edmonton, CA	1
Fort Worth, US	1

17 institutions · 42 of 44 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)