Symplocos racemosa

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Symplocaceae/Symplocos

At a glance

Occurrence records845

Data sources11

Biological traits36

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Symplocos racemosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility845 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Chemical compositionLOTUS · NPASS39 compounds

Occurrence & distributionGBIF845 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

珠仔树（学名：）也称总序山矾，为山矾科山矾属下的一个植物种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length9.5 mm

Fruit length max11 mm

Fruit length min8 mm

Fruit width4.5 mm

Fruit width max5 mm

Fruit width min4 mm

Leaf size3 250 mm²

Seed volume130 mm³

Seed volume max130 mm³

Seed volume min130 mm³

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment9

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation mean865 m

Elevation min130 m

Fruit fleshinessfleshy

Growth formtree

Leaf formelliptic

Woodinesswoody

Physiology & chemistry7

Leaf c472 mg/g

Leaf dry-matter content (LDMC)374 mg/g

Leaf n14.05 mg/g

Leaf p0.73 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7 mm²/mg

⚠ sources differ — TRY: 7 mm²/mg · GIFT: 10.56 mm²/mg

Wood density744 mg/cm³

Other traits6

Leaf marginentire

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max10.75 mm²/mg

Sla min10.37 mm²/mg

03Chemical composition39 compounds

Compounds documented for Symplocos racemosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple phenolic acids13

Oleanane triterpenoids5

Flavandiols (Leucoanthocyanidins)3

Furofuranoid lignans2

Ursane and Taraxastane triterpenoids2

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[[(2R,3R,4S)-3,7-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-4-yl]oxy]-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[4-[(3S,3aR,6S,6aR)-3-(3,4-dihydroxy-5-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-hydroxy-6-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3,4-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3-hydroxy-2-(4-hydroxyphenyl)-4,5-dimethoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,4aS,6aR,6aS,6bR,8aR,12aR)-1,2,6a,6b,9,9,12a-heptamethyl-10-oxo-2,3,4,5,6,6a,7,8,8a,11,12,13-dodecahydropicene-4a-carboxylic acid	present	LOTUS
(3S,4aS,6aR,6aR,6bR,8aR,12aS,14aR,14bS)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,14a-tetradecahydropicen-3-ol	present	LOTUS
(4aS,6aS,6aS,6bR,8aS,10S,12aR,14bR)-10-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4S,4aR,6aR,6bS,8aR,12aR,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-2,4a,5,6,7,8,9,10,12,12a,14,14a-dodecahydro-1H-picen-3-one	present	LOTUS
2-[4-[3-(3,4-Dihydroxy-5-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-hydroxy-6-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
3-[[2-[6-(Benzoyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-5-hydroxyphenyl]methoxy]-2-hydroxybenzoic acid	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symplocos racemosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP818969.1 ↗530 bpIndia

ACGT

CATTGTTGCTAACTGCGTAGCAGAACAACTTGCGAACATGTATGTAATATTTGGAAAGCAAGCGGTGGCCTCGTAGCCCCAATTGTGGCC …

Symplocos racemosa voucher MSoLS_SR_R28 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Symplocos racemosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Nooteboom 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type845 records

Wild obs. + sensor248

Museum / vouchered597

Range

Area of Occupancy AOO924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 241≤1 km 3≤10 km 2

246 georeferenced · 2 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 3>10 km 2

6 georeferenced · 591 without coordinates

Open the institutions mapphysical evidence597

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	164
Beijing, CN	98
Guilin, CN	62
Guangzhou, CN	62
Pondicherry, IN	33
Nanjing, CN	16
Yangling, CN	12
Guangzhou, CN	11
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	9
Edinburgh, GB	6
Chengdu, CN	5
University of Stellenboschlocation not on record	4
nlocation not on record	4
Yunnan Universitylocation not on record	4
Honolulu, US	4
Saint Louis, US	3
Cincinnati, US	2
CASlocation not on record	2
Philadelphia, US	2
Changsha, CN	2
South Kensington, GB	2
Bronx, US	2
Kew, GB	1
H. Balslevlocation not on record	1
Vancouver, CA	1
EMTCMlocation not on record	1
Wuhan, CN	1
Shanghai, CN	1
South China Normal Universitylocation not on record	1
Paris, FR	1
BISHlocation not on record	1

31 institutions · 518 of 597 vouchered records shown · 79 without an institution code

09Environmental DNA2 detections

Where the DNA of Symplocos racemosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)