Symphytum officinale
speciesAt a glance
Occurrence records392 671
Data sources16
Biological traits48
DNA specimens24
eDNA detections12
Sources16 archives
Databases and archives Symphytum officinale's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility392 671 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources48 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS143 compounds
Occurrence & distributionGBIF392 671 records
Environmental DNA2 datasets · 4 countries12 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Symphytum officinale is a perennial flowering plant in the family Boraginaceae. Along with thirty four other species of Symphytum, it is known as comfrey. To differentiate it from other members of the genus Symphytum, this species is known as common comfrey or true comfrey. Other English names include Quaker comfrey, cultivated comfrey, boneset, knitbone, consound, and slippery-root. It is native to Europe, growing in damp, grassy places. It is locally frequent throughout Ireland and Britain on river banks and ditches. It occurs elsewhere, including North America, as an introduced species and sometimes a weed. The flowers are mostly visited by bumblebees. Internal or long-term topical use of comfrey is discouraged due to its strong potential to cause liver toxicity.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTLEDATRYAusTraits
Size & morphology13
Fruit length3.5 mm
Fruit length max4 mm
Fruit length min3 mm
Leaf mass342 mg
Leaf size6 963 mm²
⚠ sources differ — TRY: 6 963 mm² · LEDA: 8 816 mm² · GIFT: 8 816 mm²
Plant height0.584 m
⚠ sources differ — GIFT: 0.584 m · LEDA: 0.65 m · TRY: 0.78 m
Plant height generative0.625 m
Plant height max1.5 m
Plant height min0.3 m
Seed length4.5 mm
Seed mass10.57 mg
⚠ sources differ — TRY: 10.57 mg · LEDA: 8.32 mg · GIFT: 9.72 mg
Seed mass max11.13 mg
Seed mass min11.12 mg
Life cycle & reproduction13
Deciduousnessaestival
Dispersal typeanimal
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number216
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Forb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio17.16 g/g
Leaf c390 mg/g
Leaf dry-matter content (LDMC)120 mg/g
⚠ sources differ — TRY: 120 mg/g · LEDA: 81.73 mg/g
Leaf n28.68 mg/g
Leaf p5.28 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)29.79 mm²/mg
⚠ sources differ — TRY: 29.79 mm²/mg · LEDA: 27.57 mm²/mg · GIFT: 25.02 mm²/mg
Wood density101 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition143 compounds
Compounds documented for Symphytum officinale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Pyrrolizidine alkaloids23
Oleanane triterpenoids8
Isoquinoline alkaloids $ Protoberberine alkaloids7
Cinnamic acids and derivatives5
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids3
Documented compounds143 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 890,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 759,000 ppm | DukesPhytochem | |
| FIBER(DIETARY) | 480,000 ppm | DukesPhytochem | |
| MUCOPOLYSACCHARIDES | 300,000 ppm | DukesPhytochem | |
| MUCILAGE | 290,000 ppm | DukesPhytochem | |
| PROTEIN | 140,000 ppm | DukesPhytochem | |
| ASH | 140,000 ppm | DukesPhytochem | |
| GUM | 100,000 ppm | DukesPhytochem |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphytum officinale has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes5
GenBank sequences9
eDNA detections12
Countries6
The DNA barcodea real sequence read deposited for this species
CGTCACCGCATCATTAATTTTTGTGTATCGGTGGAATGTGACCTCCTGCTCCTAGTTGTGCAGTTGGTTAAAACTTGAGTATGTGGATTA …
Symphytum officinale isolate HP7C internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Symphytum officinale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 887 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Symphytum officinale1.89 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy4× / 6× cytotypes
Chromosome records24–562n range48median48mode66records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4837×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — PERUZZI L., GARBARI F., BOTTEGA S. - 2001. Symphytum tanaicense Steven (Boraginaceae) new for the Italian Flora. Willdenowia , 31(1): 33-41.
CCDB · slov-fl — Migra V., 1982: Zytotaxonomische Probleme ausgewählter Taxa der Flora des Babia Hora - Bergmassivs (Gebirge Západné Beskydy) I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 87-95.
CCDB · slov-fl — Murín A. & Májovský J., 1982: Die Bedeutung der Polyploidie in der Entwicklung der in der Slowakei wachsenden Arten der Gattung Symphytum L. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 1-25.
CCDB · brit-fl — Gadella, T.W.J., Kliphuis, E., Perring, F.H. Acta Bot. Neerl. 23: 433-437 (1974)
CCDB · brit-fl — Marks, G.E. (1975)
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Sekovski, Z. & M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Ann. Fac. Biol. Univ. Skopje. 36: 73–86.
CCDB · ipcn-api-dl — Gadella, T. W. 1983. Enkele floristische en cytotaxonomische waaremingen op Schiermonnikoog. Gorteria 10: 227–229.
CCDB · ipcn-api-dl — Krahulcová, A. 1988. Selected chromosome counts of the Czechoslovak flora I. Folia Geobot. Phytotax. 23: 375–381.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., E. KLIPHUIS, & K.U. KRAMER. 1970. Zytotaxonomische Untersuchungen an Blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · book-ipcn73-74 — MARKOVA, M.L., & P. IVANOVA. 1974. In IOPB chromosome number report' XLIV. Taxon 23: 373-380.
CCDB · book-fedorov — Tamavschi 1948
CCDB · book-fedorov — Gadella, Kliphuis 1967
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1972). Studies in chromosome numbers of Yugoslavian Angiosperms. Acta Bot. Croat. 31: 91-103.
CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Kramer, K. U. (1970). Zytotaxonomische untersuchungen an blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · CromoCat 2015 — Jaarsma, T. A., Lohmanns, E., Gadella, T. W. J. & Malingré, T. M. (1989). Chemotaxonomy of the Symphytum officinale agg. (Boraginaceae). Pl. Syst. Evol. 167(3/4): 113-127.
CCDB · CromoCat 2015 — Krahulcová, A. (1988). Selected chromosome counts of the Czechoslovak flora I. Folia Geobot. Phytotax. 23: 375-381.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Markova, M. & Ivanova, P. (1970). Karyologische Untersuchung der Vertreter der fam. Boraginaceae, Labiateae und Scrophulariaceae in Bulgarien. Bull. Inst. Bot. 20: 93-98.
CCDB · CromoCat 2015 — Peev, D. (1975b). Chromosome numbers and karyotypes. Compt. Rend. Acad. Bulg. Sci. 28: 521-523.
CCDB · CromoCat 2015 — Markova, M. & Ivanova, P. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 378.
2n 2413×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · brit-fl +4
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — Bottega S., Garbari F., Peruzzi L. - 2000. Aspetti biosistematici di popolazioni toscane afferenti a Symphytum gr. officinale (Boraginaceae). "Problematiche di Biologia Vegetale in Ambiente Mediterraneo", 95 Congresso della S.B.I. , : 71.
CCDB · ita-fl — PERUZZI L., GARBARI F., BOTTEGA S. - 2001. Symphytum tanaicense Steven (Boraginaceae) new for the Italian Flora. Willdenowia , 31(1): 33-41.
CCDB · ita-fl — BOTTEGA S., GARBARI F., PERUZZI L. - 2001. Mediterranean chromosome number reports - 11.. Flora Mediterranea , 11: 436-439.
CCDB · brit-fl — Gadella, T.W.J., Kliphuis, E., Perring, F.H. Acta Bot. Neerl. 23: 433-437 (1974)
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Mekki, L., H. t. Hart, N. Z. El-Alfy, A. Dewedar & T. W. J. Gadella. 1987. The Giemsa C-banded karyotype of diploid Symphytum officinale (Boraginaceae). Acta Bot. Neerl. 36: 33–37.
CCDB · eflora
CCDB · CromoCat 2015 — Gadella, T. W. J. & Kliphuis, E. (1978). Cytotaxonomic studies in the genus Symphytum. VlII. Chromosome numbers and classification of ten European species. Proc. K. Nederl. Akad. Wetensch. Amsterdam, Ser. C, 81: 162-172
CCDB · CromoCat 2015 — Huizing, H. J. (1985). Phytochemistry, systematics and biogenesis of pyrrolizidine alkaloids of Symphytum taxa. Thesis, Meppel.
2n 407×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn73-74 +2
CCDB · ipcn-api-dl — Wang, G., Z. Li & Q. Meng. 1983. An observation of chromosome numbers of Comfrey from different sources. Acta Phytotax. Sin. 21: 55–59.
CCDB · ipcn-api-dl — Huizing, H. J. 1985. Phytochemistry, systematics and biogenesis of pyrrolizidine alkaloids of Symphytum taxa. Thesis, Meppel. ý.
CCDB · ipcn-api-dl — Gadella, T. W., E. KLIPHUIS & H. J. Huizing. 1983. Cyto- and chemotaxonomical studies on the sections Officinalia and Coerulea of the genus Symphytum. Bot. Helv. 93: 169–192.
CCDB · book-ipcn72 — GVINIASHVILI, TS. N. 1972. Some data on the karyology of Caucasic species of Symphytum L. with respect to their taxonomy. (In Russian). Bot. Zurn. 57: 1120-1126.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Cytotaxonomic studies in the genus symphytum. v. some notes on W. European plants with the chromosome number 2n=40. Bot. Jahrb. 93: 530-538. 1973.
CCDB · CromoCat 2015 — Huizing, H. J. (1985). Phytochemistry, systematics and biogenesis of pyrrolizidine alkaloids of Symphytum taxa. Thesis, Meppel.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 365×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of plants of the Primorsky Territory, the Amur River basin and Magadan region. Bot. Žhurn. (Moscow & Leningrad) 91(3): 491–509.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-atlas-flowering-plants — Suzuka 1950
CCDB · book-atlas-flowering-plants — Maude 1939
2n 442×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Gadella, T.W.J., Kliphuis, E., Perring, F.H. Acta Bot. Neerl. 23: 433-437 (1974)
2n 452×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — SHIRATO, K., T. Shintani, G. Nakanishi & A. Kamizy;afo. 1985. Chromosome numbers in genus Symphytum. Chromosome Inf. Serv. 38: 21–23.
2n 541×CCDB · fl-europaea
CCDB · fl-europaea — Markova & Ivanova,
2n 561×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Huizing, H. J. (1985). Phytochemistry, systematics and biogenesis of pyrrolizidine alkaloids of Symphytum taxa. Thesis, Meppel.
n 121×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — LEPPER, L. 1970. Beitrage zur Chromosomenzahlen-Dokumentation. Wiss. z. Friedrich-Schiller-Univ. Jena, Math.-Naturwiss. Reihe 19: 369-376.
n 181×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
n 241×CCDB · book-ipcn72
CCDB · book-ipcn72 — DELAY, J. 1972. Boraginacees (suite). Inf. Ann. Caryosyst. et Cytogenet. 6: 9-12.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.454 ↗
08Occurrence & distribution
Record type392 671 records
Wild obs. + sensor380 248
Museum / vouchered10 400
Cultivated / captive333
Other1 690
Origin
Native4 882
Introduced35
Range
Area of Occupancy AOO313 108 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy38% within 1 km
≤100 m 48 486≤1 km 59 603≤10 km 175 417>10 km 2 731
286 237 georeferenced · 94 011 without coordinates
Open the mapobservation + sensor380 248
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy28% within 1 km
≤100 m 467≤1 km 1 261≤10 km 4 167>10 km 194
6 089 georeferenced · 4 311 without coordinates
Open the institutions mapphysical evidence10 400
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤100 m 1≤1 km 1≤10 km 2>10 km 17
21 georeferenced · 312 without coordinates
Open the mapnot free-living333
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions165 of 313 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 908 |
| BFLlocation not on record | 435 |
| LDlocation not on record | 301 |
| Moscow State Universitylocation not on record | 222 |
| Salzburg, AT | 155 |
| Uniwersytet Warszawskilocation not on record | 146 |
| Görlitz, DE | 114 |
| Olocation not on record | 108 |
| SLU Artdatabankenlocation not on record | 103 |
| Adam Mickiewicz University in Poznańlocation not on record | 89 |
| BIO-UNIPIlocation not on record | 83 |
| Oskarshamn, SE | 79 |
| Tartu, EE | 79 |
| BRNUlocation not on record | 71 |
| Oulu, FI | 61 |
| Karlsruhe, DE | 60 |
| Bergen, NO | 60 |
| Philadelphia, US | 55 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 54 |
| Mlocation not on record | 51 |
| Provincia di Livornolocation not on record | 48 |
| Bern, CH | 44 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 41 |
| Québec, CA | 40 |
| Museo Entomologico de Leonlocation not on record | 40 |
| Philadelphia, US | 39 |
| Voronezh State Universitylocation not on record | 39 |
| Berlin, DE | 38 |
| Turku, FI | 38 |
| Trondheim, NO | 37 |
| UniKSlocation not on record | 36 |
| South Kensington, GB | 35 |
| Uppsala, SE | 32 |
| Université Lavallocation not on record | 31 |
| Chongqing Museumlocation not on record | 31 |
| Madison, US | 30 |
| New Haven, US | 28 |
| Kuopio, FI | 28 |
| Uniwersytet Śląski w Katowicachlocation not on record | 28 |
| Burlington, US | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| KMNlocation not on record | 21 |
| DBF-NHMDlocation not on record | 21 |
| Bronx, US | 20 |
| Christchurch, NZ | 19 |
| Jyväskylä, FI | 18 |
| Tallinn, EE | 18 |
| Chiba, JP | 17 |
| GJOlocation not on record | 17 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| MAlocation not on record | 16 |
| Acadia Universitylocation not on record | 15 |
| Victoria, CA | 15 |
| Paris, FR | 15 |
| WTUlocation not on record | 15 |
| BDBClocation not on record | 14 |
| Bando, JP | 14 |
| MeiseBGlocation not on record | 13 |
| Uniwersytet Opolskilocation not on record | 13 |
| University of New Hampshirelocation not on record | 12 |
| Porrentruy, CH | 12 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Ann Arbor, US | 12 |
| Frankfurt am Main | 12 |
| Tilburg, NL | 11 |
| Helsinki, FI | 11 |
| Barcelona, ES | 11 |
| TUR-Alocation not on record | 11 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 11 |
| Seoul, KR | 11 |
| Fulda, DE | 11 |
| Nagano City, JP | 11 |
| Odawara, JP | 11 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 10 |
| Canberra, AU | 10 |
| Corvallis, US | 10 |
| Winterthur, CH | 10 |
| Toyama, JP | 10 |
| Denver, US | 9 |
| Portland, US | 9 |
| Montréal, CA | 9 |
| CJBGlocation not on record | 9 |
| KURAlocation not on record | 9 |
| Vitoria, ES | 8 |
| Wlocation not on record | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| Mount Annan, AU | 8 |
| Otaru, JP | 8 |
| St. Paul, US | 8 |
| Hobart, AU | 8 |
| PrivatHerblocation not on record | 7 |
| Vancouver, CA | 7 |
| Green Bay, US | 7 |
| Wellington, NZ | 7 |
| Frauenfeld, CH | 7 |
| Auckland, NZ | 7 |
| Durham, US | 7 |
| UNESClocation not on record | 7 |
| Toronto, CA | 7 |
| Tokushima, JP | 7 |
| Dresden, DE | 7 |
| TROMlocation not on record | 7 |
| Obihiro Centennial City Museumlocation not on record | 7 |
| McWane Science Centerlocation not on record | 6 |
| València, ES | 6 |
| Kew, GB | 6 |
| Saint Louis, US | 6 |
| Shanxi Universitylocation not on record | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Bourges, FR | 6 |
| Saint John, CA | 6 |
| UGentlocation not on record | 6 |
| Tomioka, JP | 5 |
| Bozeman, US | 5 |
| Forssa, FI | 5 |
| Allentown, US | 5 |
| Pamplona, ES | 5 |
| Kushiro City Museumlocation not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Rotorua, NZ | 5 |
| Maringá, BR | 5 |
| SZUlocation not on record | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| Yangling, CN | 5 |
| Bend, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Tsukuba, JP | 5 |
| Porvoo, FI | 4 |
| Glarus, CH | 4 |
| Boise, US | 4 |
| Fukushima Universitylocation not on record | 4 |
| Blumenau, BR | 4 |
| KR | 4 |
| Criciúma, BR | 4 |
| NMBU:MINAlocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| JBRJlocation not on record | 4 |
| Riverside, US | 4 |
| BClocation not on record | 4 |
| Beijing, CN | 4 |
| Pullman, US | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Dekalb, US | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| Zürich, CH | 4 |
| BSBIlocation not on record | 3 |
| Sanda, JP | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| PUC-RSlocation not on record | 3 |
| Tula State Universitylocation not on record | 3 |
| KIRMlocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Namur, BE | 3 |
| Madrid, ES | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| GZUlocation not on record | 3 |
| Sagamihara, JP | 3 |
| University of Stellenboschlocation not on record | 3 |
| Taipei, TW | 3 |
| UTPLlocation not on record | 3 |
| NBSIlocation not on record | 3 |
| Clemson, US | 3 |
| Logan, US | 3 |
| Columbia, US | 3 |
| Bloomington, US | 3 |
| Philadelphia, US | 3 |
| Millersville, US | 2 |
| ISAlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Brasília, BR | 2 |
| Brisbane, AU | 2 |
| UFOPlocation not on record | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Santa Barbara, US | 2 |
| UFRRJlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| PRClocation not on record | 2 |
| Santa Cruz, US | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Corrientes, AR | 2 |
| Chengdu, CN | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Tacoma, US | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Seropédica, BR | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Claremont, US | 2 |
| University of Wisconsinlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| JP | 2 |
| Chengdu, CN | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Podgorica, ME | 2 |
| DULlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Davenport, US | 2 |
| Ilhéus, BR | 2 |
| FLADlocation not on record | 2 |
| Hamilton, US | 2 |
| Orem, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Long Beach, US | 1 |
| UFRPElocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Honolulu, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Shinshu Universitylocation not on record | 1 |
| Pamplona, ES | 1 |
| Mohonk Preservelocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Anchorage, US | 1 |
| Richmond, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Sion, CH | 1 |
| UIBlocation not on record | 1 |
| TAIElocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| PTHlocation not on record | 1 |
| Bangkok, TH | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| UFPRlocation not on record | 1 |
| Staten Island, US | 1 |
| Bothell, US | 1 |
| Walla Walla, US | 1 |
| Brussel, BE | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| USP-IBlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Grand Junction, US | 1 |
| Kensington, AU | 1 |
| Chapel Hill, US | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Shanghai, CN | 1 |
| Awka, NG | 1 |
| Armidale, AU | 1 |
| Zhuzhou, CN | 1 |
| Los Angeles, US | 1 |
| Urumqi, CN | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Knoxville, US | 1 |
| Fayetteville, US | 1 |
| H-Dunkellocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| College Park, US | 1 |
| Chicago, US | 1 |
| Williamsburg, US | 1 |
| AUT001location not on record | 1 |
| ROM020location not on record | 1 |
| ESP027location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| San Sebastián, ES | 1 |
| Chadron, US | 1 |
| Umeå Universitylocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| GB | 1 |
| UoB-IBlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Davis, US | 1 |
| Rovaniemi, FI | 1 |
| CASlocation not on record | 1 |
| New Brunswick, US | 1 |
| Durban, ZA | 1 |
| Granada, ES | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Dover, US | 1 |
| Masindi, UG | 1 |
| Chicago, US | 1 |
| Jaén, ES | 1 |
| Nanjing, CN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Guangzhou, CN | 1 |
| Kingston, US | 1 |
| Xiamen, CN | 1 |
| Trois-Rivières, CA | 1 |
| Northridge, US | 1 |
| Provo, US | 1 |
| IPE-CSIClocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| CBDClocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Palmerston North, NZ | 1 |
| Boumlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Osaka, JP | 1 |
| HACAMlocation not on record | 1 |
| Pelotas, BR | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| UFSClocation not on record | 1 |
| Albuquerque, US | 1 |
| UFVJMlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Lausanne, CH | 1 |
313 institutions · 8 126 of 10 400 vouchered records shown · 2 009 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Symphytum officinale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map4 countries0
rivershore
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.4 °C 4.10–17.2
Seasonal swing summer↔winter13.8 °C
Max temp (day)18.7 °C 7.70–20.3
Min temp (night)11.2 °C 0.2–14.0
Precipitation76.6 mm/mo 48.0–83.2
Air humidity62.0 % 58.4–62.9
Moisture balance-38.1 mm/mo -57.5–14.1
Vapour deficit669 Pa 312–759
Wind speed4.10 m/s 3.40–5.00
Cloud cover48.4 % 41.3–54.1
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.