Symphyotrichum anticostense

(Fernald) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Symphyotrichum

At a glance

Occurrence records203

Data sources12

Biological traits9

DNA specimens113

eDNA detections109

Sources12 archives

Databases and archives Symphyotrichum anticostense's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI109 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics113 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 1 countries109 detections

DNA & barcodingBOLD · NCBI113 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Symphyotrichum anticostense (formerly Aster anticostensis) is a species of flowering plant in the family Asteraceae endemic to Quebec, New Brunswick, and Maine. Commonly known as Anticosti aster, it is a perennial, herbaceous plant that may reach 10 to tall. Its flowers have pale purple or lilac, sometimes white, ray florets and yellow, then reddish purple, disk florets. S. anticostense herbarium specimen

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding113 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphyotrichum anticostense has left across the world's sequence archives.

At a glance

DNA specimens113

Marker genes5

GenBank sequences10

eDNA detections109

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220013.1 ↗335 bpCanada · 1931

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Symphyotrichum anticostense voucher CCDB-22989-E08 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Symphyotrichum anticostense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome records80–802n range80median80mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 802×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Brouillet, L. & J. Labrecque. 1987. Aster gaspensis Victorin: nombre chromosomique et hybridation naturelle avec l'A. novi-belgii L. Naturaliste Canad. 114: 159–165.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type203 records

Wild obs. + sensor15

Museum / vouchered185

Cultivated / captive3

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 7≤10 km 2>10 km 4

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 2≤1 km 35≤10 km 1>10 km 5

43 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence185

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montréal, CA	76
Québec, CA	44
Saint John, CA	37
Université Lavallocation not on record	18
Burlington, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
University of New Hampshirelocation not on record	2
Bloomington, US	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1

9 institutions · 184 of 185 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA109 detections

Where the DNA of Symphyotrichum anticostense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found109

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 109 detections have coordinates

Open the map1 country0

River flats.Platieres calcaires.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter30.9 °C

Max temp (day)23.7 °C

Min temp (night)14.2 °C

Precipitation97.3 mm/mo

Air humidity56.5 %

Moisture balance-41.6 mm/mo

Vapour deficit956 Pa

Wind speed2.70 m/s

Cloud cover47.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)