Symphyotrichum anomalum

(Engelm.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Symphyotrichum

At a glance

Occurrence records689

Data sources11

Biological traits10

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Symphyotrichum anomalum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility689 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF689 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Symphyotrichum anomalum (formerly Aster anomalus) is a species of flowering plant in the family Asteraceae native to Arkansas, Illinois, Kansas, Missouri, and Oklahoma. Commonly known as manyray aster, it is a perennial, herbaceous plant that may reach 20 to tall. Its flowers have lavender or blue to purple, seldom white, ray florets and cream or light yellow, then pinkish-purple disk florets. Its flowers are attractive to butterflies. The lower leaves have untoothed margins and are heart-shaped at the base. View of involucres and phyllaries

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Flowering endSep

Flowering startJul

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphyotrichum anomalum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences6

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSEU781321.1 ↗619 bp

ACGT

TCGAAGCCTGCAAAGCAAACGACCCGTGAACATGTTACAACAACTTTGCCACGATGGGTTGGGCTTTGTTCGATCCTCGTGGCACACCGT …

Symphyotrichum anomalum voucher Semple and Suripto 9950 clone 6 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Symphyotrichum anomalum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidypolyploid inferred

Chromosome records16–182n range16median16mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

CCDB · ipcn-api-dl — Semple, J. C. & L. Brouillet. 1980. Chromosome numbers and satellite chromosome morphology in Aster and Lasallea. Amer. J. Bot. 67(7): 1027–1039.

2n 181×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Avers 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.990 ↗

08Occurrence & distribution

Record type689 records

Wild obs. + sensor461

Museum / vouchered228

Range

Area of Occupancy AOO1 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 270≤1 km 38≤10 km 9>10 km 52

369 georeferenced · 92 without coordinates

Open the mapobservation + sensor461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 12≤1 km 20≤10 km 53>10 km 7

92 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	63
Wuzhou, CN	49
Bronx, US	45
Fayetteville, US	16
Bloomington, US	7
Little Rock, US	6
Pittsburg, US	5
Macomb, US	5
GB	4
Montréal, CA	3
Jefferson City, US	3
Springfield, US	2
Richmond, US	2
Jurica-Suchy Nature Museumlocation not on record	2
Emporia, US	2
Riverside, US	2
DOI/NPS, Greenbelt Parklocation not on record	1
US	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
Flagstaff, US	1
Phoenix, US	1
Logan, US	1
Chapel Hill, US	1
San Angelo, US	1
Chadron, US	1
Lubbock, US	1

27 institutions · 227 of 228 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Symphyotrichum anomalum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)