Symphyotrichum adnatum

(Nutt.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Symphyotrichum

At a glance

Occurrence records628

Data sources10

Biological traits8

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Symphyotrichum adnatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF628 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Symphyotrichum adnatum (formerly Aster adnatus) is a species of flowering plant in the family Asteraceae native to the southeastern United States and the Bahamas. Commonly known as scaleleaf aster, it is a perennial, herbaceous plant that may reach 30 to tall. Its flowers have lavender ray florets and yellow disk florets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphyotrichum adnatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences8

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJQ360448.1 ↗622 bp

ACGT

TCGAAGCCTGCAAAGCAAACGACCCGCGAACATGTTACAACAACTTGCCATGATGGGTCGGGCTTTTGTTCGATCCTCGTGGCACACCGT …

Symphyotrichum adnatum clone 5 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Symphyotrichum adnatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. & L. Brouillet. 1980. Chromosome numbers and satellite chromosome morphology in Aster and Lasallea. Amer. J. Bot. 67(7): 1027–1039.

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C. 1984. Cytogeographic studies on North American Asters. I. Range surveys of Virgulus adnatus, V. concolor, V. georgianus, V. grandiflorus, V. novae-angliae, V. oblongifolius, V. patens and V. walteri. Amer. J. Bot. 71: 522–531.

CCDB · eflora

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Turner, B. L. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type628 records

Wild obs. + sensor464

Museum / vouchered164

Range

Area of Occupancy AOO1 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 265≤1 km 33≤10 km 13>10 km 60

371 georeferenced · 93 without coordinates

Open the mapobservation + sensor464

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 11≤10 km 10>10 km 1

35 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	33
Jackson, US	23
Bronx, US	17
US	14
Jena Microbial Resource Collectionlocation not on record	10
AUAlocation not on record	9
Chapel Hill, US	8
University of Stellenboschlocation not on record	7
Tall Timbers Research Stationlocation not on record	7
Mississippi State, US	5
Montréal, CA	4
Valdosta State Universitylocation not on record	4
Bloomington, US	4
Tuscaloosa, US	4
Bangkok, TH	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
GAlocation not on record	3
Tulane Universitylocation not on record	1
Richmond, US	1
Baltimore, US	1
Wuzhou, CN	1
University of Southern Mississippilocation not on record	1
Dekalb, US	1

23 institutions · 164 of 164 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Symphyotrichum adnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)