Symphoricarpos mollis

Plantae/Tracheophyta/Magnoliopsida/Dipsacales/Caprifoliaceae/Symphoricarpos

At a glance

Occurrence records2 064

Data sources9

Biological traits18

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Symphoricarpos mollis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 064 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF2 064 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Symphoricarpos mollis, with the common names creeping snowberry, Southern California snowberry, and trip vine, is a shrub in the Honeysuckle Family (Caprifoliaceae).Flowering Plans of the Santa Monica Mountains, Nancy Dale, 2nd. Ed, 2000, p. 91 It is found in western North America from British Columbia to California inland to Nevada and Idaho.Calflora taxon report, University of California, Symphoricarpos mollis Nutt. Trailing Snowberry, creeping snowberry, snowberryJones, George Neville 1940. A monograph of the genus Symphoricarpos. Journal of the Arnold Arboretum 21(2): 201-252

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height1.05 m

Seed mass7.33 mg

Seed mass max9.27 mg

Seed mass min4.76 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry4

Leaf n16.5 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)36.56 mm²/mg

Wood density638 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphoricarpos mollis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ268143.1 ↗596 bp

ACGT

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCGTACACCGGGACGCCGGCGGGGGCGCGTCAGCCCCCCCGTCGGCGCTCCCAT …

Symphoricarpos mollis voucher SD:Marshall 218 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1rbcLaITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 064 records

Wild obs. + sensor1 626

Museum / vouchered438

Range

Area of Occupancy AOO5 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 991≤1 km 160≤10 km 50>10 km 42

1 243 georeferenced · 383 without coordinates

Open the mapobservation + sensor1 626

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 34≤1 km 181≤10 km 84>10 km 1

300 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence438

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	88
Arcata, US	73
San Diego, US	65
San Luis Obispo, US	48
Los Angeles, US	34
US	30
Irvine, US	13
Claremont, US	9
Davis, US	9
Long Beach, US	8
Severin-McDaniel Insect Collectionlocation not on record	7
Northridge, US	6
Fullerton, US	5
San Jose, US	5
Santa Cruz, US	5
Logan, US	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Wuzhou, CN	3
Fort Bragg, US	2
Truckee, US	2
LDlocation not on record	2
KNFYlocation not on record	2
Turlock, US	1
Moscow State Universitylocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Canadian Department of Agriculturelocation not on record	1
EL PASO, US	1
Ensenada, MX	1
La Paz, MX	1
STNFlocation not on record	1
KNFHClocation not on record	1
MeiseBGlocation not on record	1
Flagstaff, US	1
Calabar, NG	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Vancouver, CA	1
Catalina Island Conservancylocation not on record	1

37 institutions · 437 of 438 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Symphoricarpos mollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Pine/Oak Forest with Ceanothus palmeri, Quer…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 20.5–20.5

Seasonal swing summer↔winter13.7 °C

Max temp (day)28.2 °C

Min temp (night)13.7 °C

Precipitation3.80 mm/mo

Air humidity53.6 %

Moisture balance-154 mm/mo

Vapour deficit1,124 Pa

Wind speed1.60 m/s

Cloud cover16.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry4

At a glance

Record type2 064 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 064 records