Symphionema montanum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Symphionema

At a glance

Occurrence records442

Data sources7

Biological traits16

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Symphionema montanum's data was compiled from.

GBIFGlobal Biodiversity Information Facility442 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources16 traits

Occurrence & distributionGBIF442 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT1 Gbp

02Traits & measurements

SourcesAusTraits

Size & morphology5

Fruit length2 mm

Leaf length30 mm

Leaf mass per area85.53 g/m2

Leaf size386 mm²

Plant height0.8 m

Life cycle & reproduction6

Flowering timennnnnnnnnyyy

Life spanperennial

Lifespan years15 years

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment5

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Symphionema montanum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAF508813.1 ↗654 bp

ACGT

ATTGTCGATACCTGCCCAACAGAGAGACCCGCGAACACGTAGCAACTGCAAACAGGGGATGGAGCGTGGGAGCAAAAAGCCCCTTCCGCA …

Symphionema montanum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Symphionema montanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 007 340 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Symphionema montanum1.01 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type442 records

Wild obs. + sensor282

Museum / vouchered159

Cultivated / captive1

Origin

Native73

Introduced1

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 179≤1 km 29≤10 km 5>10 km 4

217 georeferenced · 65 without coordinates

Open the mapobservation + sensor282

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 15≤1 km 49≤10 km 60>10 km 12

136 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence159

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	75
Museo Entomologico de Leonlocation not on record	25
Canberra, AU	23
Armidale, AU	8
Brisbane, AU	6
Wollongong, AU	4
Adelaide, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	3
Hobart, AU	3
Paris, FR	2
John T. Waterhouse Herbariumlocation not on record	1
Auckland, NZ	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

14 institutions · 159 of 159 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Symphionema montanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)