Sylvicola dubius

(Macquart, 1850) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anisopodidae/Sylvicola

At a glance

Occurrence records1 480

Data sources5

Biological traits0

DNA specimens248

eDNA detections249

Sources5 archives

Databases and archives Sylvicola dubius's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 480 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI249 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics248 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 480 records

Environmental DNA1 datasets · 3 countries249 detections

DNA & barcodingBOLD248 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding248 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sylvicola dubius has left across the world's sequence archives.

At a glance

DNA specimens248

BINs3

Marker genes1

eDNA detections249

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus232 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

153Cmostly conserved

156Tmostly conserved

159Amostly conserved

171Tmostly conserved

180Avariable

183Amostly conserved

237Tmostly conserved

357Amostly conserved

369Avariable

399Tmostly conserved

411Avariable

432Amostly conserved

450Amostly conserved

477Tmostly conserved

486Cmostly conserved

513Amostly conserved

561Tmostly conserved

564Tmostly conserved

576Avariable

ACATTATATTTTATTTTTGGAGCTTGAGCAAGAATAGTAGGAACTTCACTTAGAATACTTATTCGAGCTGAATTAGGTCATCCAGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes21

BINs3

Most divergent pair12.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hydrophorus altivagussame order10.8%Anopheles nitidussame order11.1%Anopheles vanderwulpisame order11.4%Hydrophorus innotatussame order11.6%Hydrotaea irritanssame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 480 records

Wild obs. + sensor1 060

Museum / vouchered420

Origin

Native70

Range

Area of Occupancy AOO2 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 485≤1 km 124≤10 km 122>10 km 124

855 georeferenced · 205 without coordinates

Open the mapobservation + sensor1 060

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 48≤1 km 30≤10 km 145>10 km 12

235 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence420

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	263
MWLRlocation not on record	70
Tasmanian Museum & Art Gallerylocation not on record	57
Auckland, NZ	14
Wellington, NZ	7
Natick, US	6
University of Glasgow, Hunterian Museumlocation not on record	1

7 institutions · 418 of 420 vouchered records shown · 2 without an institution code

09Environmental DNA249 detections

Where the DNA of Sylvicola dubius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found249

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 249 detections have coordinates

Open the map3 countries0

1. Forest & WoodlandForest14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 9.40–15.3

Seasonal swing summer↔winter9.80 °C

Max temp (day)14.9 °C 12.6–19.2

Min temp (night)7.50 °C 5.50–10.7

Precipitation120 mm/mo 74.8–139

Air humidity62.7 % 60.3–65.1

Moisture balance37.2 mm/mo -49.7–89.2

Vapour deficit516 Pa 429–691

Wind speed4.10 m/s 1.70–4.60

Cloud cover34.5 % 27.2–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 248 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sylvicola dubius

At a glance

Sources5 archives

At a glance

Record type1 480 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 480 records