Sylvia melanocephala

(Gmelin, 1789) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Sylviidae/Sylvia

At a glance

Occurrence records364 588

Data sources9

Biological traits30

DNA specimens7

eDNA detections14

Sources9 archives

Databases and archives Sylvia melanocephala's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF364 588 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Die Samtkopf-Grasmücke (Sylvia melanocephala) ist ein Singvogel aus der Gattung der Grasmücken (Sylvia). Sie kommt im Mittelmeerraum vor, ist wenig scheu und zeigt sich oft.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology13

Beak depth3 mm

Beak length (culmen)13.7 mm

Beak length (nares)7.3 mm

Beak width2.9 mm

Body mass11.7 g

Body mass (female)11.9 g

Body mass (male)11.6 g

Hand-wing index18

Kipp's distance10.5 mm

Secondary length48 mm

Tail length61.3 mm

Tarsus length20.4 mm

Wing length58.7 mm

Life cycle & reproduction5

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass1.73 g

Litter size4.35

Max. longevity99.6 months

Diet & foraging8

Fruit40 %

Ground20 %

Invertebrate50 %

Midhigh20 %

Nectar10 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory60 %

Habitat & environment4

HabitatShrubland

Migration2.0

Primary lifestyleInsessorial

Range size1 781 821 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sylvia melanocephala has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

6Tmostly conserved

51Cmostly conserved

126Tmostly conserved

228Tmostly conserved

351Avariable

390Tmostly conserved

426Gmostly conserved

492Amostly conserved

584Amostly conserved

586Cmostly conserved

587Tmostly conserved

588Cmostly conserved

CTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCTGGCGCCCTCCTGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.95%

Haplotypes3

BIN1

Most divergent pair1.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sylvia mystaceasame genus4.6%Sylvia cantillanssame genus5.7%Curruca cantillanssame family5.7%Curruca subalpinasame family6.0%Curruca iberiasame family6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sylvia melanocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 075 537 326 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sylvia melanocephala1.08 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type364 588 records

Wild obs. + sensor362 857

Museum / vouchered1 663

Cultivated / captive52

Fossil4

Other12

Origin

Native152 949

Range

Area of Occupancy AOO76 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 43 351≤1 km 76 982≤10 km 67 712>10 km 6 204

194 249 georeferenced · 168 608 without coordinates

Open the mapobservation + sensor362 857

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 2≤1 km 11≤10 km 82>10 km 33

128 georeferenced · 1 535 without coordinates

Open the institutions mapphysical evidence1 663

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 52 records without

Open the mapnot free-living52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sevilla, ES	1 478
Barcelona, ES	59
IMEDEAlocation not on record	36
Cambridge, US	20
EEZAlocation not on record	11
Natural History Museum Rotterdamlocation not on record	11
SMNHTAUlocation not on record	10
Frankfurt am Main	6
Salzburg, AT	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Kristiansand, NO	2
Auckland, NZ	2
Edmonton, CA	2
Washington, US	2
Iowa City, US	1
Philadelphia, US	1
Provincia di Livornolocation not on record	1
Banyoles, ES	1
Seattle, US	1
Ugentlocation not on record	1
Musée des Confluenceslocation not on record	1
Zografou, GR	1

22 institutions · 1 653 of 1 663 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Sylvia melanocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 16.9–20.8

Seasonal swing summer↔winter9.10 °C

Max temp (day)19.1 °C 18.0–26.0

Min temp (night)16.4 °C 14.5–17.8

Precipitation14.2 mm/mo 1.70–24.5

Air humidity59.3 % 50.6–62.6

Moisture balance-98.0 mm/mo

Vapour deficit852 Pa 744–1,256

Wind speed5.40 m/s

Cloud cover34.0 % 20.9–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sylvia melanocephala

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction5

Diet & foraging8

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type364 588 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type364 588 records