Syagrus glaucescens

Glaz. ex Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Syagrus

At a glance

Occurrence records83

Data sources11

Biological traits27

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Syagrus glaucescens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Syagrus glaucescens is a species of flowering plant in the family Arecaceae. It is endemic to Minas Gerais state in southeastern Brazil. Its small population is threatened by collecting and habitat destruction.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length25 mm

Fruit length max30 mm

Fruit length min20 mm

Fruit width20.5 mm

Fruit width max25 mm

Fruit width min16 mm

Leaf length max1 000 mm

Plant height5 m

Plant height max5 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatemontane tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourbrown

Growth formtree

Habitat GIFTCampo de Altitude, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Vegetação Sobre Afloramentos Rochosos

Woodinesswoody

Other traits6

Dbh max12 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max500 cm

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syagrus glaucescens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAY044634.1 ↗1 488 bp

ACGT

ATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAA …

Syagrus glaucescens ribulose bisphosphate carboxylase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Syagrus glaucescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Röser, M., M. A. T. Johnson & L. Hanson. 1997. Nuclear DNA amounts in palms (Arecaceae). Bot. Acta 110: 79–89.

CCDB · kew — Röser M, Johnson MAT, Hanson L. 1997. Nuclear DNA amounts in palms (Arecaceae). Botanica Acta 110: 79-89.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type83 records

Museum / vouchered83

Origin

Native37

Range

Area of Occupancy AOO184 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence83

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
USP-IBlocation not on record	20
Université de Bordeauxlocation not on record	19
JBRJlocation not on record	7
Bronx, US	4
Kew, GB	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
University of Stellenboschlocation not on record	3
UFVJMlocation not on record	3
Brasília, BR	2
Uberlândia, BR	2
UnBlocation not on record	2
Cenargenlocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
UFOPlocation not on record	2
Ural Federal University "B. N. Yeltsin"location not on record	2
FPMZBlocation not on record	1
JBPlocation not on record	1
Miami, US	1
Bogotá, D.C., CO	1
UTFPR-CPlocation not on record	1

20 institutions · 83 of 83 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Syagrus glaucescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)