Swintonia floribunda — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Swintonia

At a glance

Occurrence records50

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Swintonia floribunda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF50 records

DNA & barcodingNCBIsequences

01Narrative

Swintonia floribunda is a tree species in the family Anacardiaceae. It can be found in the Andaman Islands, Indo-China and Malesia through to Sumatra. The Catalogue of Life lists one subspecies: S. floribunda var. penangiana (King) K.M. Kochummen, which is found in peninsular Malaysia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height25 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density613 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Swintonia floribunda has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOK605282.1 ↗465 bpBangladesh · 2020

ACGT

TTTAATAGTACATCCCAATATGGGACGGCCATACTTGTTCAATTTATCTCTCTCAACTTGGATCCCATGCGGTGGTCCTTGGAAAGTTTT …

Swintonia floribunda isolate 19 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type50 records

Wild obs. + sensor1

Museum / vouchered49

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	2
Xiamen, CN	1
Moscow State Universitylocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Edinburgh, GB	1

6 institutions · 7 of 49 vouchered records shown · 42 without an institution code