Swertia perennis
speciesAt a glance
Occurrence records25 868
Data sources14
Biological traits30
DNA specimens22
eDNA detections43
Sources14 archives
Databases and archives Swertia perennis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility25 868 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources30 traits
Chemical compositionLOTUS · NPASS63 compounds
Occurrence & distributionGBIF25 868 records
Environmental DNA2 datasets · 5 countries43 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB2n = 28
01Narrative
La Swertie vivace est une espèce de plantes à fleurs de la famille des Gentianaceae. Elle est présente dans plusieurs régions de l'hémisphère nord, dont la plupart de l'Eurasie et de l'Amérique du Nord. Elle est protégée localement en France dans plusieurs régions.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Plant height0.26 m
Plant height generative0.278 m
Plant height max0.6 m
Plant height min0.08 m
Seed length2 mm
Seed mass0.347 mg
⚠ sources differ — TRY: 0.347 mg · LEDA: 0.361 mg · GIFT: 0.37 mg
Seed mass max0.52 mg
Seed mass min0.24 mg
Life cycle & reproduction10
Deciduousnessevergreen
Dispersal typeself
Flowering endSep
Flowering startJul
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTmeadows: wet, swamps
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Leaf dry-matter content (LDMC)157 mg/g
Photosynthetic pathwayC3
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition63 compounds
Compounds documented for Swertia perennis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Plant xanthones8
Carbazole alkaloids6
Anthracyclines6
Flavones5
Methyl xanthones $ Plant xanthones4
Documented compounds63 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (5R)-8,10-dihydroxy-2,5-bis(hydroxymethyl)-5-methylnaphtho[2,3-c]isochromene-7,12-dione | present | NPASS | |
| (7S,9R,10R)-10-[(2S,4S,5S,6S)-4-(dimethylamino)-5-hydroxy-6-methyloxan-2-yl]oxy-9-ethyl-4,6,7,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione | present | NPASS | |
| (7S,9R,10R)-7,10-bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-1,4,6,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione | present | NPASS | |
| (7S,9R,10R)-7,10-Bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-4,6,9,11-tetrahydroxy-8,10-dihydro-7H-tetracene-5,12-dione | present | NPASS | |
| 1,2,6,8-Tetrahydroxyxanthone | present | LOTUS | |
| 1,2,6-trihydroxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyxanthen-9-one | present | LOTUS | |
| 1,2,6-trihydroxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxyxanthen-9-one | present | LOTUS | |
| 1,3,5-Trihydroxy-8-[(2R,3S,4R,5R,6S)-3,4,5-Trihydroxy-6-(Hydroxymethyl)Oxan-2-Yl]Oxyxanthen-9-One | present | NPASS | |
| 1,5-dihydroxy-3-methoxy-8-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyxanthen-9-one | present | NPASS | |
| 1,7-Dihydroxy-3,8-dimethoxyxanthone | present | LOTUS |
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Swertia perennis has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes6
GenBank sequences10
eDNA detections43
Countries7
The DNA barcodea real sequence read deposited for this species
TCGCGTCGCCCCCCAACCCCGTGTGTTAACTCGTACGGGTGACGTGTGGGGGCGGAAAATGGCTTCCCGTGCTTGGTGCGGCTGGCCTAA …
Swertia perennis internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Swertia perennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records18–282n range28median28mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2815×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +5
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · fl-europaea — Skalinska, et al.,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1986. Chromosome Number Reports 93. Taxon 35: 897–899.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Tan, K. & V. Vladimirov. 2001. Swertia punctata Baumg. (Gentianaceae) in Bulgaria. Bocconea 13: 461–466.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-fedorov — CoKOJIOBCKaH, crpexKOBa, 1940, i948a
CCDB · book-fedorov — Favarger 1952b
CCDB · book-fedorov — Skaliiiska et al. 1959
CCDB · book-atlas-flowering-plants — Favarger 1952b
CCDB · CromoCat 2015 — Dawe, J. C. & Murray, D. F. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 265-268.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1986). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XCIII]. Taxon 35(4): 897-899.
CCDB · CromoCat 2015 — Speta, F. (1974a). Chromosomenzahlen und strukturen der arbeitskerne diverser Angiospermen Naturk. Jahrb. Stadt Linz 20: 155-180.
CCDB · CromoCat 2015 — Murín, A. & J. Májovský. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 487-488.
2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Sakai K. 1935a
CCDB · book-atlas-flowering-plants — Sakai 1935
2n 242×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Woycicki 1937
CCDB · book-atlas-flowering-plants — Woycicki 1937
n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Post, D. M. 1983. In IOPB chromosome number reports. Taxon 32: 509.
CCDB · book-ipcn67-71 — DELAY, J. 1970. Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
CCDB · CromoCat 2015 — Post, D. M. (1983). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXX]. Taxon 32(3): 509.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type25 868 records
Wild obs. + sensor22 454
Museum / vouchered2 800
Cultivated / captive1
Other613
Range
Area of Occupancy AOO17 324 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy25% within 1 km
≤100 m 3 475≤1 km 874≤10 km 13 061>10 km 290
17 700 georeferenced · 4 754 without coordinates
Open the mapobservation + sensor22 454
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 123≤1 km 582≤10 km 1 209>10 km 21
1 935 georeferenced · 865 without coordinates
Open the institutions mapphysical evidence2 800
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions82 of 139 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Zürich, CH | 606 |
| Zürich, CH | 258 |
| Uniwersytet Wrocławskilocation not on record | 199 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 113 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 109 |
| BFLlocation not on record | 94 |
| Mlocation not on record | 84 |
| Denver, US | 63 |
| Salzburg, AT | 62 |
| WTUlocation not on record | 58 |
| Missoula, US | 48 |
| Moscow, US | 48 |
| Bern, CH | 46 |
| Tartu, EE | 39 |
| Philadelphia, US | 35 |
| Albuquerque, US | 33 |
| Pullman, US | 33 |
| Logan, US | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 27 |
| Barcelona, ES | 26 |
| Entomological Society of Latvialocation not on record | 24 |
| Rocky Mountain Biological Laboratorylocation not on record | 22 |
| BIO-UNIPIlocation not on record | 21 |
| LfUlocation not on record | 20 |
| BDBClocation not on record | 17 |
| DOI/NPS, Greenbelt Parklocation not on record | 17 |
| Provincia di Livornolocation not on record | 17 |
| LDlocation not on record | 17 |
| MAlocation not on record | 17 |
| BRNUlocation not on record | 16 |
| Durango, US | 16 |
| BClocation not on record | 16 |
| Bozeman, US | 15 |
| GZUlocation not on record | 15 |
| Wuzhou, CN | 15 |
| Porrentruy, CH | 15 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 15 |
| Tallinn, EE | 14 |
| Bronx, US | 14 |
| Pocatello, US | 14 |
| Adam Mickiewicz University in Poznańlocation not on record | 13 |
| Claremont, US | 13 |
| Oskarshamn, SE | 12 |
| Moscow State Universitylocation not on record | 11 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 11 |
| Vancouver, CA | 10 |
| GJOlocation not on record | 10 |
| Riverside, US | 10 |
| València, ES | 9 |
| San Sebastián, ES | 9 |
| Grand Junction, US | 8 |
| Görlitz, DE | 8 |
| Dresden, DE | 8 |
| Boise, US | 8 |
| Anchorage, US | 8 |
| Vitoria, ES | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Emporia, US | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Flagstaff, US | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Paris, FR | 6 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| ASUlocation not on record | 6 |
| Provo, US | 6 |
| Caldwell, US | 6 |
| Saint Louis, US | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Salamanca, ES | 5 |
| Santa Barbara, US | 5 |
| CJBGlocation not on record | 5 |
| St. Paul, US | 5 |
| Chongqing Museumlocation not on record | 5 |
| San Luis Obispo, US | 5 |
| Bourges, FR | 4 |
| Corvallis, US | 4 |
| Wlocation not on record | 4 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 4 |
| Glarus, CH | 4 |
| Victoria, CA | 4 |
| US | 4 |
| Gijón, ES | 4 |
| Badajoz, ES | 4 |
| University of Stellenboschlocation not on record | 4 |
| San Angelo, US | 3 |
| EL PASO, US | 3 |
| Bangkok, TH | 3 |
| SZUlocation not on record | 3 |
| Pamplona, ES | 3 |
| Chadron, US | 3 |
| Bloomington, US | 3 |
| Davis, US | 3 |
| Orem, US | 3 |
| IFR-DNFlocation not on record | 3 |
| Uppsala, SE | 3 |
| Whitehorse, CA | 3 |
| Kostrzyca Forest Gene Banklocation not on record | 3 |
| PRClocation not on record | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| Henderson, US | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Northridge, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Angwin, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Pittsburg, US | 2 |
| Phoenix, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Madrid, ES | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Chicago, US | 1 |
| Berlin, DE | 1 |
| Millersville, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Arcata, US | 1 |
| Los Angeles, US | 1 |
| Montréal, CA | 1 |
| Salvador, BR | 1 |
| Long Beach, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Kew, GB | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Beijing, CN | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Sion, CH | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Columbia, US | 1 |
| Granada, ES | 1 |
| Weber State Universitylocation not on record | 1 |
| STNFlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Taipei, TW | 1 |
| Austin, US | 1 |
| Mississippi State, US | 1 |
139 institutions · 2 754 of 2 800 vouchered records shown · 44 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Swertia perennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.70 °C 9.70–10.0
Seasonal swing summer↔winter19.8 °C
Max temp (day)13.5 °C 13.2–13.5
Min temp (night)5.70 °C 5.70–6.50
Precipitation129 mm/mo 129–135
Air humidity64.9 % 64.8–64.9
Moisture balance59.8 mm/mo 59.8–62.5
Vapour deficit423 Pa 419–423
Wind speed3.80 m/s
Cloud cover37.4 % 37.4–42.6
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.