Swertia japonica

(Schult.) Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Swertia

At a glance

Occurrence records794

Data sources11

Biological traits4

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Swertia japonica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility794 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionLOTUS · NPASS272 compounds

Occurrence & distributionGBIF794 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Ломатогониум колесовидный - вид травянистых растений рода Ломатогониум (Lomatogonium) семейства Горечавковые (Gentianaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formannual or biennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition272 compounds

Compounds documented for Swertia japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Secoiridoid monoterpenoids46

Cinnamic acids and derivatives20

Ursane and Taraxastane triterpenoids16

Flavones14

Iridoids monoterpenoids12

Documented compounds272 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(+)-alpha-Cyperone	present	LOTUS
(+)-alpha-Pinene	present	NPASS
(+)-gamma-Eudesmol	present	LOTUS
(+)-Menthone	present	LOTUS
(+)-pulegone	present	LOTUS
(+)-Ursolic Acid	present	NPASS
(-)-alpha-Curcumene	present	LOTUS
(-)-beta-Pinene	present	NPASS
(-)-Caryophyllene	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Swertia japonica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF096789.1 ↗231 bp

ACGT

CGCATCGCGTCGCCCCCCGACCCCGTGTGTTAACTCGTACGGGTGATGTGAGGGGGCGGAAGCTGGCTTCCCGTGCTTGGCCGCGGCTGG …

Swertia japonica isolate KMS0212B01 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Swertia japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–282n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · book-ipcn67-71 · CCDB · book-fedorov · CCDB · Cave1956supp

CCDB · book-ipcn67-71 — WADA, z. 1966. Chromosome numbers in Gentianaceae. Chromosome Inf. Serv. 7: 28-30.

CCDB · book-fedorov — Wada 1960

CCDB · Cave1956supp — Wada 1955

2n 281×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Tschechow 1931

n 102×CCDB · book-ipcn67-71 · CCDB · Cave1956supp

CCDB · book-ipcn67-71 — WADA, z. 1966. Chromosome numbers in Gentianaceae. Chromosome Inf. Serv. 7: 28-30.

CCDB · Cave1956supp — Wada 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type794 records

Wild obs. + sensor198

Museum / vouchered595

Cultivated / captive1

Range

Area of Occupancy AOO2 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 8≤1 km 6>10 km 11

25 georeferenced · 173 without coordinates

Open the mapobservation + sensor198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 15≤10 km 22>10 km 9

46 georeferenced · 549 without coordinates

Open the institutions mapphysical evidence595

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bando, JP	87
Odawara, JP	60
Kochi, JP	52
Chiba, JP	44
Tomioka, JP	34
Nagano City, JP	32
Sendai, JP	29
Fukushima Universitylocation not on record	27
KURAlocation not on record	27
Tsukuba, JP	26
Sanda, JP	22
Kagoshima, JP	22
JP	22
Osaka, JP	18
Tokushima, JP	17
Toyama, JP	11
Akita Prefectural Museumlocation not on record	10
Korea National Arboretumlocation not on record	7
FFPRIlocation not on record	6
Toyota city nature sanctuarylocation not on record	6
Nishihara, JP	5
Sagamihara, JP	4
KIRMlocation not on record	4
Kawasaki Shi Tama Ku, JP	3
Museum Of Natural And Environmental History, Shizuokalocation not on record	3
J.F.Oberlin Universitylocation not on record	2
University of Stellenboschlocation not on record	2
National Institute of Biological Resourceslocation not on record	2
KR	1
Kyoto Universitylocation not on record	1
SIHUlocation not on record	1
Cambridge, US	1
Nishihara, JP	1
NSMKlocation not on record	1
Shinshu Universitylocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
Zürich, CH	1
Hokkaido University Museumlocation not on record	1

38 institutions · 594 of 595 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Swertia japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)